Embedded Scribd iPaper - Requires Javascript and Flash Player

Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 Yin, R.H. 74
INTRODUCTION
Melamine, a nitrogen heterocyclic triazine compound, is ex-
tensively used in the production of plastics, glues, kitchen-
ware, commercial flters, dishware and fabrics (1, 2). When
added to the foodstufs it falsely elevates the apparent protein
concentration due to its high nitrogen content (approximate-
ly 66 % by molecular weight) (3). Tus, melamine was found
to be illicitly mixed into pet food and milk to increase the
apparent protein concentration (4, 5). Although, the acute
toxicity of melamine alone was shown to be low in mam-
mals (6, 7), the combination of melamine with cyanuric acid
was considered to be responsible for the crystalluria, kidney
stones and subsequent renal failure in animals (8). Terefore,
the renal toxicity of melamine has become an area of concern
to nephrologists (8).
In recent years, however, it has been increasingly appre-
ciated that the toxicity of melamine might not be limited
to the kidneys (8). It was demonstrated that melamine not
only inhibits the proliferation of diferentiated PC12 cells
through the induction of apoptosis (9), but also afects the
Efect of Melamine on Immunohistochemical Expression of
Bax/Bc1-2 Protein in Testis and ER-α/PR mRNA in
Ovary With or Without Cyanuric Acid in Mice
Yin, R.H.,
1
Wang, W.C.,
1
Wang, X.Z.,
1
Wang, X.,
1
Yin, R.L.,
2
Bai, W.L.,
1
* Wu, C.D.,
1
Li, C.,
3
Liu, J.,
1
Liu, B.S.
1
and He, J.B.
1
*
1
College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Shenyang 110866, China
2
Research Academy of Animal Husbandry and Veterinary Medicine Sciences of Jilin Province, Changchun 130062, China
3
Institute of Military Veterinary, Academy of Military Medical Sciences, Changchun, 130062, China
* Corresponding Author: Wen L. Bai. Email: baiwenlin55@163.com; Jian B. He. Email: hejianbin69@163.com.
ABSTRACT
Melamine is a nitrogen heterocyclic triazine compound whose acute toxicity was considered to be low
in mammals. Te combined ingestion of melamine and cyanuric acid was shown be responsible for the
crystalluria, kidney stones and subsequent renal failure in animals. In the present study, we investigated in
mice the potential efects of melamine on immunohistochemical expression of Bax/Bc1-2 protein in testis
and the estrogen receptor-α (ER)/progesterone receptor (PR) mRNA in the ovary with or without cyanuric
acid. Our results indicated that at the dose range used, exposure to melamine alone or combination with
cyanuric acid promoted the expression of Bax protein, and suppressed the expression of Bcl-2 protein in testis
of male mice in a dose-dependent manner. Te relative expression of ER-α in ovary was signifcantly down-
regulated in the animals from the melamine high dose group (50 mg/kg), as well as in the mixture groups of
melamine and cyanuric acid at low (each at 1 mg/kg), middle (each at 5 mg/kg) and high doses (each at 25
mg/kg). Te changing pattern of PR mRNA in the animals treated with melamine alone or combination of
melamine and cyanuric acid were similar to those of ER-α mRNA. Compared with control group, however,
no signifcant diference was observed in relative expression of PR mRNA in co-administration group of
melamine and cyanuric acid with low dose (each at 1 mg/kg, P > 0.05). Tese results from the present study
may provide useful information for evaluating the melamine-related reproductive toxicity in mammals.
Keywords: Mouse, Melamine, Cyanuric acid, Bax/Bc1-2, Testis, ER-α/PR, Ovary.
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 75 Efect of Melamine on Testis and Ovary in Mice
morphology and caspase-3 activity of hippocampus neu-
rons (10). Also, it was reported that melamine may cause
sperm deformity and DNA damage (11, 14). Additionally,
Xie et al., (2011) demonstrated that the co-administration of
melamine and cyanuric acid resulted in damage to the liver in
mice in a dose-dependent pattern (13). In our recent study,
we also demonstrated that melamine resulted in certain ul-
trastructural pathological injuries to the liver, kidney, spleen,
stomach wall, and small intestine of mice (12).
Te reproductive system is more sensitive to toxic chemi-
cals in comparison to other system (15, 16). Testis and ovary
are the primary organs of the reproductive system in mam-
mals. It was reported that melamine alone or its combination
with cyanuric acid resulted in the damage to the testis of mice
(14, 17), and the melamine-related toxicity was found to be
related to germ cell apoptosis (18). However, it is unclear
whether the increase in apoptotic index of the germ cells is
a direct or indirect efect (12, 17).
Bax and Bcl-2 are two crucial genes participating in
apoptotic process. Bax protein promotes the apoptotic cell
death through inserting into the mitochondrial membrane
and increasing membrane permeability (19, 20), whereas Bcl-
2 protein prevents this process by preserving mitochondrial
integrity (21). Terefore, the balance between Bax and Bcl-2
is crucial for the induction of apoptosis.
Tere is a dearth of information about the toxic efects
of melamine alone or its combination with cyanuric acid on
the ovary in mammals. Trough investigation of gene knock-
out mice it has been demonstrated that estrogen receptor-α
(ER-α) and progesterone receptor (PR) play critical roles
in the regulation of the reproductive physiology of female
mice (22, 23).
Te purpose of the present study was to investigate the
potential efects of melamine on immunohistochemical ex-
pression of Bax/Bc1-2 protein in testis and ER-α/PR mRNA
in ovary with and without cyanuric acid in mice.
MATERIALS AND METHODS
Animals
A total of 56 healthy male mice of the Kunming strain (3
week-old, 25-30 g) were used provided by Beijing Fukang
Biological Technology Co., Ltd. (license No.: SCXK ( Jing)
2009-0004, Beijing, China). Another 56 healthy female
mice of the Kunming strain (3 week-old, 25-30 g) were ob-
tained from China Medical University (license No.: SCXK
(Liao) 2008-0005, Shenyang, China), All animal protocols
were reviewed and approved by the Animal Experimental
Committee of Shenyang Agricultural University.
Animal grouping and material administration
Te mice were maintained in controlled laboratory condi-
tions of 12 h dark/light cycle and 22±2°C temperature with
a relative humidity of 35-65%. After seven days of acclima-
tion, the male mice were randomly divided into seven groups
of eight mice each, i.e. one control group, three melamine
groups (low, middle, and high doses) and three mixture group
of melamine and cyanuric acid (low, middle, and high dos-
es). Te eight animals of each group were housed together.
Te animals had free access to water and standard labora-
tory food (containing 24% protein, 4% fat and about 5%
fber) that was provided by the experimental animal cen-
ter of Liaoning University of Traditional Chinese Medicine
(Shenyang, China). All feeds and water were subjected for
the detection of melamine or cyanuric acid contaminants as
the described by Heller et al. (2008) (24). Neither melamine
nor cyanuric acid was detected above the limit of 0.5 ppm.
Te mice of melamine group were administered with
melamine (> 99%, Sinopharm Chemical Reagent Beijing
Co., Ltd, Beijing, China) at doses of 2 mg/kg (low dose), 10
mg/kg (middle dose) and 50 mg/kg (high dose) twice daily.
Te mice of mixture groups were administered with the com-
bination of melamine and cyanuric acid (> 98%, Shanghai
Crystal Pure Industrial Co., Ltd, Shanghai, China) at the
dosages consisting of 1 mg/kg (low dose), 5 mg/kg (middle
dose) and 25 mg/kg (high dose) twice daily. Te mice of con-
trol group were administered 1 mL of physiological saline.
All administrations were performed via gastric gavages for
30 days. At the end of the experiment, all mice of each group
were sacrifced by cervical dislocation, and the testis tissues
of male mice and ovary tissue of female mice were collected
immediately from each mouse.
Immunohistochemical detection of Bax and Bcl-2
protein in the testis of male mice
Te testis tissue collected was fxed in 10% neutral formalin
for 24 hours and then embedded in parafn. Serial sections
(4 µm) were cut and mounted on poly-l-lysine coated slides.
Te sections were deparafnized and rehydrated routinely.
Te sections were incubated with 0.3% H
2
O
2
for 30 min to
Research Articles
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 Yin, R.H. 76
block endogenous peroxidase activity, and then were washed
with distilled water for 3 times. Antigens were retrieved
through heating the sections in a microwave oven (pH 6.0
for 20 min). Slides were allowed to cool, and subsequently
were washed twice in PBS-bufer (pH 7.3). Slides were incu-
bated with primary antibodies against Bax (Boster, Wuhan,
China) or Bcl-2 (Boster, Wuhan, China) at 37 °C for 1 h. Te
slides were covered with coverslips in order to ensure that the
whole section was coated with the antibody solution. After
washing three times for 2 minutes with PBS (pH 7.3), the
slides were further incubated with the secondary antibody.
Te reaction results were visualized using DAB chromogen.
Te results were analyzed using the JD-801 morphological
microscopic image analysis system ( JieDa Biotechnology
Co. Ltd., Jiangsu, China).
Detection of ER-α/PR mRNA in ovary of female mice
Using Trizol reagent (Sangon, Shanghai, China), total RNA
was extracted from the ovary tissue of the female mice fol-
lowing the manufacturer’s instructions. Te integrity of total
RNA extracted was verifed with 1.5% agarose gel electro-
phoresis. Te purity and quantity of the extracted total RNA
were assessed in an ultraviolet spectrometer with the ratio
of OD
260
/OD
280
being 1.8 to 2.0 for each sample. Te total
RNA was treated with DNase to exclude the contamina-
tion from residual genomic DNA. Using M-MuLV cDNA
Synthesis Kit (Sangon, Shanghai, China), the frst strand
cDNA was synthesized with 1µg of total RNA for each sam-
ple according to the manufacturer’s instructions. A negative
control was included for each sample without template RNA.
Te cDNA was diluted 1:20 with DNase/RNase free water.
Four primers were designed according to the sequences of
ER-α (NM_007956.4) and PR (NM_008829.2) mRNA in
GenBank. Also, another pair of primers targeting the β-actin
gene (accession number in GenBank: NM_007393.3) was
designed as an internal control. Te information on these
primers is shown in Table 1. Te specifcity of the primer
sets was confrmed by testing them on the frst-stand cDNA
obtained from this work in a preliminary PCR experiments
with subsequent sequencing analysis.
We prepared the 10-fold dilution of cDNA obtained
from ovary tissue total RNA, and produced a 6-point stan-
dard curve for each gene under analysis. Te real-time PCR
reaction was carried out in a 20 µL fnal volume contain-
ing 10 µL 2 × SYBR
®
Premix Ex Taq
TM
(TaKaRa, Dalian,
China), 0.4 µL forward primer (10 µM), 0.4 µL reverse prim-
er (10 µM), 2.0 µL frst-strand cDNA, and 7.2 µL PCR
grade water. Using SYBR Green I assay, the amplifcation
was carried out in a LightCycler 480 Termal Cycler (Roche
Diagnostics, Germany) with the following program: 95°C
for 4 min, then 40 cycles of the following: 95°C for 15s,
54-56 °C (Table 1) for 1 s, and 72°C for 20s. At the end of
each real-time PCR, a melting curve analysis ranging from
65 to 95°C was performed for each sample to confrm the
presence of one gene-specifc single peak for each primer
set. All reactions were run in triplicate. A negative control
without cDNA template was included in each measurement.
Te real time PCR efciency (E) were calculated by the given
slopes from the instrument’s software using the equation
E = 10
(-1/slope)
.
Statistical analysis
Data was tested for normal distribution. Subsequently, using
single factor analysis of variance (ANOVA), the statistical
analysis was carried out by SAS 6.12 software (SAS Institute,
Cary, NC, USA), and t-test was used as a post hoc test after
the ANOVA. Data was presented as the mean ± standard er-
ror. P < 0.05 was considered as statistically signifcant.
Table 1: Information of primers used for analyzing the expression ER-α/PR mRNA in female ovary
Primer name Gene
1
Primer
orientation
Sequence (5’–3’)
Primer
length (bp)
Annealing
temperature
(°C)
Amplicon
size (bp)
mER-FW ER-α Sense GCACCAGATCCAAGGGAA 18
56
150
mER-RV ER-α Anti-sense GCGGCGTTGAACTCGTAG 18
mPR-FW PR Sense CTCATAGGGAAGGAGGCAGAA 21
55
155
mPR-RV PR Anti-sense CCCAAAGAGACACCAGGAAGT 21
mACTB-FW β-actin Sense CTGTCCCTGTATGCCTCTG 19
54
221
mACTB-RV β-actin Anti-sense TTGATGTCACGCACGATT 18
1
ER-α = Estrogen receptor- α, and PR = Progesterone receptor
Research Articles
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 77 Efect of Melamine on Testis and Ovary in Mice
RESULTS
Clinical observations
Troughout the experiment, no death was recorded for the
male mice used for investigating immunohistochemical ex-
pression of Bax/Bc1-2 protein in testis. Only three female
mice used for analyzing ER-α/PR mRNA in ovary, all of
which received a co-administration of the high group of
melamine and cyanuric acid (each at 25 mg/kg/day), died at
days 19, 25 and 28, respectively, and they exhibited anorexia,
dull hair coat, decreased activity and a hunched posture be-
fore death.
At the end of the experiment, the mice treated with the
combination of melamine and cyanuric acid (25mg/kg/2
day) had a lower body weight versus the control group, but
without statistical signifcance (P > 0.05). At necropsy, the
kidneys of survival mice appeared pale yellow in color and
were grossly enlarged. No changes were noted in the other
organs including testis of male mice and ovaries of female
mice.
Immunohistochemical changes of Bax and Bcl-2
protein in the testis in male mice
As observed from Figure 1, the positive expression of Bax
protein was primarily observed in cytoplasm and cell mem-
branes showing difuse or linear staining. Te animals from
melamine-treated group with high dose (50 mg/kg/ 2 days)
exhibited a strong positive reaction (Figure 1 D). Similar re-
sults were also observed in the animals from mixture groups
of melamine and cyanuric acid with middle (each at 5 mg/
kg) and high (each at 25 mg/kg) doses (Figure 1 F and G).
However, other groups exhibited moderate or weak positive
reactions (Figure 1 A, B, C and E).
On the other hand, the Bax protein was expressed mainly
in the spermatogonia and primary spermatocytes of seminif-
erous tubules. Also, Bax protein was observed in spermato-
genic cells at all levels for the mice from melamine-treated
group with high dose (50 mg/kg/ 2 days), as well as mixture
groups of melamine and cyanuric acid with middle (each at
5 mg/kg) and high (each at 25 mg/kg) doses. Additionally,
Bax protein was found to be expressed abundantly even in
the stromal cells of these mice.
As shown in Table 2, on the whole, the expression level
of Bax protein was low in seminiferous tubules of the mice
from control group. Compared with control group, however,
the average optical density value of Bax protein expression
was signifcantly higher in the melamine-treated high dose
group (50 mg/kg) compared to the control group (P < 0.05).
Similarly, in comparison to the control group, the average
optical density value of Bax protein expression had a sig-
nifcant increase in mixture group of melamine and cyanuric
Figure 1: Testicular section from diferent treated groups showed
expression changes of Bax protein in male mice that were detected by
immunohistochemical assay (×200). (A) control group; (B) Melamine-
treated group with low dose (2 mg/kg); (C) Melamine-treated groups
with middle dose (10 mg/kg); (D) melamine-treated groups with high
dose (50 mg/kg); (E) Co-adminstration of melamine and cyanuric acid
with low dose (each at 1 mg/kg); (F) Co-adminstration of melamine and
cyanuric acid with middle dosage (each at 5 mg/kg); (G) Co-adminstration
of melamine and cyanuric acid with high dose (each at 25 mg/kg).
Research Articles
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 Yin, R.H. 78
acid with both middle dose (each at 5 mg/kg) and high dose
(each at 25 mg/kg/2 day, P < 0.01). Also, positive expression
area of Bax protein in diferent degrees was observed with
diferent doses of both melamine alone and combination of
melamine and cyanuric acid in a dose-dependent manner.
Tese results suggested that the ingestion of melamine alone
or combination with cyanuric acid can promote the expres-
sion of Bax protein in testis of male mice.
As shown in Figure 2, the positive expression of Bcl-2
protein was observed in spermatogenic cells at all levels. Te
Bcl-2 protein was expressed mainly in the spermatogonia
and primary spermatocytes of seminiferous tubules and stro-
mal cells. In the animals from melamine-treated group, Bcl-2
protein was localized in the cytoplasm and cell membrane
exhibiting a moderate or weak positive reaction. As shown
in table 2, in comparison to control group, the average opti-
cal density value of Bcl-2 protein expression was signifcant-
ly lower in the animals from melamine-treated group with
high dose (50 mg/kg) compared to the control group (P <
0.01). Also, the co-administration of melamine and cyanu-
ric resulted in a signifcantly lower average optical density
value of Bcl-2 expression in the animals from both middle
dose (each at 5 mg/kg) and high dose (each at 25 mg/kg,
P < 0.01) compared with control group. A dose-dependent
manner was observed in the average optical density value
of Bcl-2 expression in the exposure to melamine alone or
the combination with cyanuric acid. Tese results suggested
that the ingestion of melamine alone or combination with
cyanuric acid can suppress the expression of Bcl-2 protein
in testis of male mice.
Figure 2: Testicular section from diferent treated groups showed
expression changes of Bcl-2 protein in male mice that were detected by
immunohistochemical assay (×200). (A) Control group; (B) Melamine low
dose group (2 mg/kg); (C) Melamine middle dose groups (10 mg/kg);
(D) Melamine high dose group (50 mg/kg); (E) Mix low dose group of
melamine and cyanuric acid (each at 1 mg/kg); (F) Mix middle dose group
of melamine and cyanuric acid (each at 5 mg/kg); (G) Mix high dose group
of melamine and cyanuric acid (each at 25 mg/kg).
Table 2: Efect of melamine on immunohistochemical expression of
Bax/Bc1-2 protein in testis with or without cyanuric acid in mice
Groups Optical density
of Bax protein
Optical density
Bc1-2 protein
Bax/Bc1-2
Control 0.3458±0.0532 0.3512±0.0468 0.98
Melamine (low, 2
mg/kg)
0.2869±0.0765 0.2882±0.0631 1.0
Melamine (moderate,
10 mg/kg)
0.3387±0.0496 0.2788±0.0584 1.21
Melamine (high,50
mg/kg)
0.3751±0.0753
*
0.192±0.0759
**
1.95
Mixture of melamine
and cyanuric acid
(low, 1 mg/kg/ 2
days)
0.3657±0.0895 0.3176±0.0438 1.15
Mixture of melamine
and cyanuric acid
(middle, 5 mg/kg/ 2
days)
0.4107±0.0326
**
0.2432±0.0568
*
1.69
Mixture of melamine
and cyanuric acid
(high, 25 mg/kg/ 2
days)
0.4575±0.0653
**
0.1835±0.0732
**
2.49
In comparison to control group, * indicates statistical signifcance
diference at P < 0.05, and ** indicates statistical signifcance diference
at P < 0.01.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 79 Efect of Melamine on Testis and Ovary in Mice
Additionally, in comparison to control group, a greater
ratio of Bax against Bcl-2 was observed in the exposure to
both melamine alone and combination of melamine and
cyanuric acid with the increased of dose (Table 2).
Changes of ER/PR mRNA in ovary of female mice
We investigated the efect of melamine alone or com-
bination with cyanuric acid on the expression of ER-α
and PR mRNA in ovary of female mice using real-time
PCR technique. Te obtained results were presented in
Figure 3. With the increasing of dosage, the animals
treated with melamine alone with diferent concentra-
tion (2 mg/kg/, 10 mg/kg, 50 mg/kg, respectively) had a
decreasing tendency in the relative expression of ER-α
mRNA (Figure 3a). In comparison to control group, the
animals treated with high dose of melamine alone (50
mg/kg) showed a signifcant decrease in relative expres-
sion of ER-α mRNA (P < 0.05). Although the animals
from the mixture group of melamine and cyanuric acid
also exhibited similar tendency to those treated with
melamine alone, less abundance of ER-α mRNA was
observed in the animals from co-administration group
(Figure 3a). Compared with the control group, the rela-
tive expression of ER-α mRNA exhibited a signifcant
decrease in mixture group of melamine and cyanuric acid
with low dose (1 mg/kg, P < 0.05), middle dose (2 mg/kg,
P < 0.01), and high dose (1 mg/kg, P < 0.01). Te results
on relative expression of PR mRNA were presented in
Figure 3b. As shown, the change pattern of PR mRNA
in the animals treated with melamine alone or combina-
tion of melamine and cyanuric acid were high similar to
those of ER mRNA. In comparison to control group,
however, no signifcant diference was observed in rela-
tive expression of PR mRNA of co-administration group
of melamine and cyanuric acid with low dose (1 mg/kg
P < 0.01) (Figure 3b).
Figure 3: Te efect of melamine alone or combination
with cyanuric acid on the relative expression of ER and
PR mRNA in ovary of female mice. (a) Expression
changes of ER mRNA in ovary of female mice. (b)
Expression changes of ER mRNA in ovary of female
mice. Te expression abundance of ER and PR
mRNA were normalized against the internal control
gene β-actin. Bars represent the means ± standard
error. In comparison to control group, * standing for
signifcant diference (P < 0.05), and ** standing for
signifcant diference (P < 0.01). C = Control group,
M-L = Melamine low dosage group (2 mg/kg), M-M
= Melamine middle dosage group (10 mg/kg), M-H =
Melamine high dosage group (50 mg/kg), M + C - L
= Mixture low dosage group of melamine and cyanuric
acid (each at 1 mg/kg), M + C - M = Mixture middle
dosage group of melamine and cyanuric acid (each at 5
mg/kg), and M + C - H = Mixture high dosage group
of melamine and cyanuric acid (each at 25 mg/kg).
Research Articles
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 Yin, R.H. 80
DISCUSSION
Melamine alone was generally considered to be of low acute
toxicity in mammals (6, 7, 25). It was recorded that melamine
was also attempted as a potential anti-cancer agent in the
1960’s and 1970’s, but was afterwards discarded due to its
lack of efcacy (26). However, studies have demonstrated
that the combination of melamine with cyanuric acid can
cause crystalluria, kidney stones and nephrotoxicity in an-
imals (8, 27-29). Tus, investigations of melamine-relat-
ed toxicity have mainly focused on the melamine-induced
lesions to kidneys. However, the reproductive toxicity of
melamine has been less extensively investigated, although
it was reported that melamine can pass through the blood-
testes barrier, and cause infertility and fetal toxicity (30-32).
Until recently, several studies demonstrated that exposure
to melamine alone or combination with cyanuric acid can
lead to the DNA damage and deformity of sperm (11, 14),
Moreover, pathological changes were observed in the testes
of mice orally administered with melamine alone or com-
bination with cyanuric acid combination (14, 17). Tese re-
sults suggested that exposure to melamine alone or combi-
nation with cyanuric acid can lead to damage to testes in
mice and that the toxicity of melamine appears to have been
underestimated.
Apoptosis is a gene-regulated process that can be in-
duced by many chemical agents (33, 34). In a recent study,
we demonstrated that, in male mice, the ingestion of
melamine alone or combination with cyanuric acid can lead
to an increase in apoptotic index of spermatogenic cells in
a dose-dependent manner (14), but it is unknown if the in-
crease in apoptotic index noted is a direct or indirect efect.
In the present study, we investigated the efect of melamine
alone or combination with cyanuric acid on expression of
2 crucial genes participating in apoptotic process, namely
Bax (an apoptosis promoter) and Bcl-2 (an apoptosis inhibi-
tor). Our data indicated that, within the dose range used,
exposure to melamine alone or combination with cyanuric
acid promoted the expression of Bax protein, and suppressed
the expression of Bcl-2 protein in testis of male mice in a
dose-dependent manner (Table 2). Tese results are gener-
ally consistent with those reported recently by Hua et al.
(2012) (8), and supported the previous fndings that inges-
tion of melamine alone or in combination with cyanuric
acid can induce apoptosis in the mice testes (8, 14). Also,
our results were similar to those reported that melamine can
induce apoptosis in diferentiated PC12 cells and preneo-
plastic urothelial cells (9, 35).
During early apoptosis, Bax is inserted into the mi-
tochondrial membrane and increases the permeability of
membrane, ultimately leading to apoptotic cell death of the
cell (19, 20). Bcl-2 protein on the other hand prevents this
process through preserving mitochondrial integrity (21).
Terefore the expression balance between Bax and Bcl-2 is
pivotal to the induction of apoptosis. It has been demon-
strated that where the ratio of Bax/Bcl-2 is higher than 1,
the cells are sensitive to proapoptotic agents (36). In the pres-
ent study, our results indicated that the ratio of Bax/Bcl-2
increases in groups of both melamine alone and the combi-
nation groups of melamine and cyanuric acid in a dose-de-
pendent manner (Table 2). Tus, it might be suggested that
the testes cells of male mice are sensitive to melamine alone
or the combination with cyanuric acid, and Bax and Bcl-2
may play critical roles in the melamine-induced apoptosis of
testes cells in male mice (14). Tese data from this study are
providing insight into the molecular mechanisms underlying
the melamine-induced apoptosis in the testes of male mice.
Tere are two ER subtypes including ER-α and ER-β,
which are encoded by ESR1 and ESR2 genes, respectively.
On the whole, ER-α is considered to be the main recep-
tor for estrogen (37). Estrogen acts through ER-α at the
hypothalamus-hypophysis-ovary (HPO) axis to stimulate
the release of gonadotrophins, and ultimately plays a role in
the regulation of folliculogenesis (38). Studies have dem-
onstrated that female ER-α knockout mice had the defects
of anovulation and infertility, which suggested the impor-
tance of ER-α in the reproductive system in female mice
(23). In the present study, the relative expression of ER-α in
ovary was signifcantly down-regulated in the animals from
melamine high dose group (50 mg/kg), as well as mixture
groups of melamine and cyanuric acid at low (1 mg/kg),
middle (5 mg/kg) and high doses (25 mg/kg) (Figure 3a).
Tese results suggested that melamine might be toxic to the
female reproductive system of mice through changing the
expression level of ER-α in the ovary, especially in the pres-
ence of cyanuric acid.
PR is the member of nuclear receptor superfamily, and is
thought to act as transcriptional factor that regulate gene ex-
pression by interacting with cognate DNA sequences. Also, it
plays a critical role in the regulation of reproductive physiolo-
Research Articles
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 81 Efect of Melamine on Testis and Ovary in Mice
gy (25). It was reported that PR knockout mice are incapable
of undergoing ovulation, even in response to gonadotropin
challenge, further indicating that PR is necessary for ovula-
tion (39, 40). In the present study, melamine caused signif-
cant decrease in the relative expression of PR in ovary of the
female mice administrated with melamine alone (50 mg/
kg), the combination of cyanuric acid (each at 5 or 25 mg/
kg) (Fig. 3b) compared with the mice from control group.
Terefore, it can be suggested that melamine might cause
certain toxic efects to the ovulation process of female mice.
In conclusion, the results from the present study indi-
cated that the ingestion of melamine alone or combination
with cyanuric acid melamine can promote the expression of
Bax protein, but suppress the expression of Bcl-2 protein
in testis of male mice. On the other hand, melamine can
cause the decrease of expression level of ER-α and PR in
ovary of female mice, especially in the presence of cyanuric
acid. Tese results from the present study might be useful
in evaluating the melamine-related reproductive toxicity in
mammals. Also, they would contribute to the existing toxic
profle of melamine.
ACKNOWLEDGEMENTS
Tis work was supported fnancially by the National Natural
Science Foundation of China (No.31001088), a Foundation for
University Talents of Liaoning Province of China (LJQ2013070),
and the Projects of Tianzhushan Person of Outstanding Ability of
Shenyang Agricultural University (Shenyang, Liaoning, China).
REFERENCES
1. Nilubol, D., Pattanaseth, T., Boonsri, K., Pirarat, N. and Leep-
ipatpiboon, N.: Melamine- and cyanuric acid-associated renal
failure in pigs in Tailand. Vet. Pathol. 46:1156-1159, 2009.
2. Shen, H.Y., Liu, Y.Q., Gao, J., Zhen, H.M., Zhu, N., and Li, J.:
In vitro study of DNA interaction with melamine and its related
compounds. DNA Cell Biol. 30:255-264, 2011.
3. Puschner, B. and Reimschuessel, R.: Toxicosis caused by mela-
mine and cyanuric acid in dogs and cats: uncovering the mys-
tery and subsequent global implications. Clin. Lab. Med. 31:181-
199, 2011.
4. Xin, H. and Stone, R.: Tainted milk scandal. Chinese probe un-
masks high-tech adulteration with melamine. Science 322: 1310-
1311, 2008.
5. Lachenmeier, D.W., Humpfer, E., Fang, F., Schütz, B., Dvort-
sak, P., Sproll, C., Spraul, M.: NMR-spectroscopy for nontar-
geted screening and simultaneous quantifcation of health-rele-
vant compounds in foods: the example of melamine. J. Agr. Food
Chem. 57:7194-7199, 2009.
6. Melnick, R.L., Boormanm, G.A., Haseman, J.K., Montali, R.J.
and Huf, J.: Urolithiasis and bladder carcinogenicity of mela-
mine in rodents. Toxicol. Appl. Pharm. 72:292–303, 1984.
7. Brown, C.A., Jeong, K.S., Poppenga, R.H., Puschner, B., Miller,
D.M., Ellis, A.E., Kang, K.I., Sum, S., Cistola, A.M. and Brown,
S.A.: Outbreaks of renal failure associated with melamine and
cyanuric acid in dogs and cats in 2004 and 2007. J. Vet. Diagn.
Invest. 19:525-531, 2007.
8. Hau, A.K., Kwan, T.H. and Li, P.K.: Melamine toxicity and the
kidney. J. Am. Soc. Nephrol. 20:245-250, 2009.
9. Han, Y.G., Liu, S.C., Zhang, T., Yang, Z.:Induction of apoptosis
by melamine in diferentiated PC12 cells. Cell Mol. Neurobiol.
31:65-71, 2011.
10. Wang, Y., Liu, F., Wei, Y. and Liu, D.: Te efect of exogenous
melamine on rat hippocampal neurons. Toxicol. Ind. Health
27:571-576, 2011.
11. Zhang, Q.X., Yang, G.Y., Li, W.X., Zhang, B. and Zhu, W.: Mel-
amine induces sperm DNA damage and abnormality, but not ge-
netic toxicity. Regul. Toxicol. Pharmacol. 60:144-150, 2011.
12. Yin, R.H., Wang, X., Wang, X.Z., Bai, W.L., Yin, R.L., Wu,
C.D., Li, C., Liu, J., Liu, B.S. and He, J.B.: Efect of Melamine in
the Absence and Presence of Cyanuric Acid on Ultrastructure of
Visceral Organs in Male Mice. Isr. J. Vet. Med. 68: 56-64, 2013.
13. Xie, Z., Yuan, H., Chen, Q., Guo, C., Zhu, L., Deng, S., Yang, Y.
and Wei, Q. Study on compound of melamine and cyanuric acid
on liver damage in mice. Chinese J. Vet. Sci. 31:1348-1353, 2011.
14. Yin, R.H., Wang, X.Z., Bai, W.L., Wu, C.D., Yin, R.L., Li, C.,
Liu, J., Liu, B.S. and He, J.B.: Te reproductive toxicity of mela-
mine in the absence and presence of cyanuric acid in male mice.
Res. Vet.Sci. 94:618-627, 2013.
15. Klimowicz, M.D., Nizanski, W., Batkowski, F. and Savic, M.A.:
Te comparison of assessment of pigeon semen motility and
sperm concentration by conventional methods and the CASA
system (HTM IVOS). Teriogenology 70:77–82, 2008.
16. Momose-Sato, Y., Mochida, H., and Kinoshita, M.: Origin of the
earliest correlated neuronal activity in the chick embryo revealed
by optical imaging with voltage-sensitive dyes. Eur. J. Neurosci.
29:1-13, 2009.
17. Lv, Y., Liu, Z., Tian, Y. and Chen, H. Efect on morphology, oxi-
dative stress and energy metabolism enzymes in the testes of mice
after a 13-week oral administration of melamine and cyanuric
acid combination. Regul. Toxicol. Pharm. 65:183-188, 2013.
18. You, H., Zhu, J., She, R., Chang, L., Shi, R., Ding, Y., Chi, L.,
Liu, B., Yue, Z., Tian, J., Mao, J. and Su, L.: Induction of apopto-
sis in the immature mouse testes by a mixture of melamine and
cyanuric acid. J. Integr. Agric. 11: 2058-2066, 2012.
19. Chan, S.L. and Yu, V.C.: Proteins of the bcl-2 family in apopto-
sis signalling: from mechanistic insights to therapeutic opportu-
nities. Clin. Exp. Pharmacol. Physiol. 31:119-128, 2004.
20. Baell, J.B. and Huang, D.C.: Prospects for targeting the Bcl-2
family of proteins to develop novel cytotoxic drugs. Biochem.
Pharmacol., 64: 851-863, 2002.
21. Kirkin, V., Joos, S. and Zörnig, M.: Te role of Bcl-2 family mem-
bers in tumorigenesis. Biochim. Biophys. Acta 1644:229-249,
2004.
22. Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Grone-
Research Articles
Israel Journal of Veterinary Medicine  Vol. 69 (2)  June 2014 Yin, R.H. 82
meyer, H. and Chambon, P.: Two distinct estrogen-regulated
promoters generate transcripts encoding the two functionally dif-
ferent human progesterone receptor forms A and B. EMBO J.
9:1603-1614, 1990.
23. Matthews, J. and Gustafsson, J.A.: Estrogen signaling: a subtle
balance between ER α and ER β. Mol. Interv. 3:281-292, 2003.
24. Heller, D.N., and Nochetto, C.B.: Simultaneous determination
and confirmation of melamine and cyanuric acid in animal feed
by zwitterionic hydrophilic interaction chromatography and tan-
dem mass spectrometry. Rapid Commun. Mass Spectrom. 22,
3624–3632, 2008.
25. Baynes, R.E, Smith, G., Mason, S.E., Barrett, E., Barlow, B.M.
and Riviere, J.E.: Pharmacokinetics of melamine in pigs follow-
ing intravenous administration. Food Chem. Toxicol. 46:1196-
1200, 2008.
26. Langman, C.B., Alon, U., Ingelfnger, J., Englund, M., Saland,
J.M., Somers. M.J., Stapleton, F.B., Sibú, N.O., Cochat, P., Wong,
W., Eke, F.U., Satlin, L. and Salusky, I.: A position statement on
kidney disease from powdered infant formula-based melamine
exposure in Chinese infants. Pediatr. Nephrol. 24: 1263-1266,
2009.
27. Puschner, B., Poppenga, R.H., Lowenstine, L.J., Filigenzi, M.S.
and Pesavento, P.A.: Assessment of melamine and cyanuric acid
toxicity in cats. J Vet Diagn Invest, 19:616-624, 2007.
28. Chen, K.C., Liao, C.W., Cheng, F.P., Chou, C.C., Chang, S.C.,
Wu, J.H., Zen, J.M., Chen, Y.T. and Liao, J.W.: Evaluation of
subchronic toxicity of pet food contaminated with melamine and
cyanuric acid in rats. Toxicol. Pathol. 37:959-968, 2009.
29. Reimschuessel, R., Evans, E., Andersen, W.C., Turnipseed, S.B.,
Karbiwnyk, C.M., Mayer, T.D., Nochetto, C., Rummel, N.G. and
Gieseker, C.M.: Residue depletion of melamine and cyanuric
acid in catfish and rainbow trout following oral administration. J.
Vet .Pharmacol. Ter. 33:172-182, 2009.
30. Bradley, M.O. and Dysart, G.: DNA single-strand breaks, dou-
ble-strand breaks, and crosslinks in rat testicular germ cells:
measurements of their formation and repair by alkaline and neu-
tral filter elution. Cell Biol. Toxicol. 1:181-195, 1985.
31. Bock, M. and Jackson, H.: Te action of triethylenemelamine on
the fertility of male rats. Br. J. Pharmacol. Chemother. 12, 1-7,
1957.
32. Generoso, W.M., Rutledge, J.C., Cain, K.T., Hughes, L.A. and
Downing, D.J.: Mutagen-induced fetal anomalies and death fol-
lowing treatment of females within hours after mating. Mutat.
Res. 199:175-181, 1988.
33. Poncet, K.M. and Kroemer, G.:Chemotherapy: targeting the mi-
tochondrial cell death pathway. Oncogene 57:8786-803, 2002.
34. Fulda, S.: Modulation of apoptosis by natural products for cancer
therapy. Planta Med. 76:1075–1079, 2010.
35. Cremonezzi, D.C., Silva, R.A., del Pilar Díaz, M., Valen-
tich, M.A. and Eynard, A.R.: Dietary polyunsatured fatty acids
(PUFA) diferentially modulate melamine-induced preneoplastic
urothelial proliferation and apoptosis in mice. Prostag. Leukotr.
Ess. 64:151-159, 2001.
36. Raisova, M., Hossini, A.M., Eberle, J., Riebeling, C., Wieder,
T., Sturm, I., Daniel, P.T., Orfanos, C.E. and Geilen, C.C.: Te
Bax/Bcl-2 ratio determines the susceptibility of human melano-
ma cells to CD95/Fas-mediated apoptosis. J. Invest. Dermatol.
117:333-340, 2001.
37. Liu, L., Tan, R., Cui, Y., Liu, J. and Wu, J.: Estrogen receptor
α gene (ESR1) polymorphisms associated with idiopathic pre-
mature ovary failure in Chinese women. Gynecol. Endocrinol.
29:182-185, 2013.
38. Kolibianakis, E.M., Papanikolaou, E.G., Fatemi, H.M. and Dev-
roey, P.: Estrogen and folliculogenesis: is one necessary for the
other? Curr. Opin. Obstet. Gynecol.17:249-253, 2005.
39. Conneely, O.M., Lydon, J.P., DeMayo, F.J., Shyamala, G., and
O’Malley, B.W.: Physiological consequences of progesterone re-
ceptor ablation in mice. Te 77th Annual Meeting of the Endo-
crine Society, Abstract, Washington, DC, USA, 1995.
40. Pinter, J.H., Deep, C. and Park-Sarge, O.K.:Progesterone recep-
tors: expression and regulation in the mammalian ovary. Clin.
Obstet. Gynecol. 39: 424-35, 1996.
Research Articles