Embedded Scribd iPaper - Requires Javascript and Flash Player

Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 Zhu, Z.B. 14
Immune Responses to a Streptococcus GapC Chimera and its
Potential Use as a Vaccine Candidate for Bovine Mastitis
Zhu, Z.B.,
1,#
Zhang, H.,
2,#
Che, C.,
1
Ma, J.Z.,
2
Song, B.F.,
2
Tong, C.Y.,
2
Yu, L.Q.,
2
Wu, Z.J.
2
and Cui, Y.D.
1,2,*
#
Both authors contributed equally to this work.
1
College of Animal Science and Veterinary Medicine, HeiLongJiang BaYi Agricultural University, Daqing 163319, China.
2
College of Life Science and Technology, HeiLongJiang BaYi Agricultural University, Daqing 163319, China.
*
Corresponding Author: Prof. Yudong Cui, Tel: +86 459 6819290, Fax: +86 459 6819290, Email: cuiyudong@yahoo.com
ABSTRACT
Although bovine mastitis caused by Streptococcus strains is the most economically important disease
afecting the dairy industry worldwide, the development of an efective vaccine has been hampered for many
years. In this study, fve S. agalactiae, three S. dysgalactiae, and three S. uberis were identifed out of thirteen
Streptococcus strains isolated during a study of clinical bovine mastitis from seven farms in China. Te gapC
genes, encoding the cell surface-associated GapC proteins of S. agalactiae, S. dysgalactiae and S. uberis were
cloned and sequenced. To further identify potential vaccine candidates against Streptococcus-induced bovine
mastitis, mice were vaccinated with GapC of S. agalactiae, S. dysgalactiae and S. uberis, resulting in a signifcant
humoral immune for three weeks post-challenge. Tis observation together with previous studies conducted
in our laboratory on GAPDH activity of Staphylococcus aureus possibly makes this protein an important target
for vaccine development against bovine mastitis.
Keywords: Mastitis; Streptococcus; GapC; Vaccine
INTRODUCTION
Bovine mastitis, an infammation of the mammary gland,
is the single most important factor contributing to eco-
nomic losses to the dairy industry (1). Several Streptococcal
species are capable of causing infections that result in
mastitis, including S. agalactiae, S. dysgalactiae, S. uberis.
and S. agalactiae which are well known worldwide as major
contagious pathogens causing bovine sub-clinical mastitis,
which may have a substantial impact to the quantity and
quality of milk. Pathogens can survive for long periods only
within the mammary gland (2). S. dysgalactiae and S. uberis
are more prevalent, infecting mammary glands as favorable
conditions arise (3). S. dysgalactiae is isolated frequently from
intra-mammary infections during lactation and during the
non-lactating period. In spite of its high prevalence, little
is known about factors that contribute to the virulence of
S. dysgalactiae (3). S. uberis is particularly problematic due
to the fact that this so-called ‘environmental Streptococcus’ is
ubiquitous in the dairy environment and is predominantly
associated with sub-clinical mastitis, resulting in reduced,
and poor quality milk yields (4, 5).
Currently, prophylactic practices including antibiotic
therapy and teat disinfection are relied upon to minimize
the spread of infection. However, these measures are often
inadequate, simply because animals are constantly being
re-exposed to infection from their surrounding environ-
ment. Vaccination is a common and easy strategy for the
control of infectious diseases, but none of these vaccines are
guaranteed to efciently control the most common mastitis-
causing pathogens. Vaccination is currently used as one such
measure with most vaccines composed of killed bacterial cells
or bacterial products that elicit protection against a variety of
strains. Immunization with autogenous whole cell bacterins
have not always resulted in protection against new infec-
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 15 Bovine Mastitis Vaccine
tions and specifc antigen fractions do not elicit heterologous
protection (6, 7). Tese fndings suggest that isolates from
diferent sources encode distinct products and that a vaccine
composed of all the diferent antigens would be impractical
to produce. Recently, a new approach has been undertaken
consisting of vaccination of a protein which resulted in partial
protection against a Streptococcal experimental challenge in
mice and dairy cows (7, 8). Terefore, as a frst step in the de-
velopment of improved vaccines capable of global protection
against Streptococcal infections, the identifcation of conserved
antigens produced by all strains must be carried out.
Te factors involved in virulence of mastitis isolates of
Streptococcus are not well understood and they include cell-
surface proteins (9, 10), adhesin-like molecules (11, 12),
and the Crp family regulatory protein factor (CAMP) (13).
Several potential virulence determinants have been described
that might contribute to mastitis caused by Streptococcus.
Resistance to phagocytosis is conferred by a hyaluronic acid
situated in the capsule (14), and the organism has also been
shown to adhere to and actively invade bovine epithelial cells
via a receptor-mediated endocytosis mechanism, where it is
able to persist without harming host cells (15). It is reported
that the M-like protein Mig of S. dysgalactiae confers pro-
tection against phagocytosis by bovine polymorphonuclear
leukocytes (PMN) (16) and that it is capable of binding to
IgA through a region located in the α2-M-binding domain
of the protein (8). Te virulence factors encoded by S. uberis
include a trypsin-resistant protein called the R-antigen, simi-
lar to the situation in S. dysgalactiae, S. uberis which possess
hyaluronic acid in the capsule which protects the bacteria
from phagocytosis (17). Hyaluronidase, neuraminidase, and a
lactoferrin-binding protein are also encoded by S. uberis (18).
Te plasma receptor protein (Plr) (19), surface dehydro-
genase protein (SDH) (20), and phosphorylating glyceral-
dehyde-3-phosphate dehydrogenase (GAPDH) have been
implicated as a potential S. pyogenes virulence factor, which
have been attributed to potentially afect host cell gene tran-
scription and thus enhancing disease pathogenicity (21). In
addition to the properties mentioned above, it has been sug-
gested that GAPDH proteins might be used as antigens in
vaccines to protect against parasitic and microbial infections.
We have recently isolated the genes encoding the GapC
products of S. agalactiae, S. dysgalactiae, and S. uberis. Tese
GapC proteins possessing GAPDH activity are located on
the surface of the bacteria and bind plasmin. Previous work
in our laboratory revealed that GapC of S. dysgalactiae, a
cell surface-associated Plr homologue, conferred signifcant
protection against S. dysgalactiae infection in dry cows when
used as a vaccine (22). Te GapC products of S. agalactiae and
S. uberis show signifcant homology to S. dysgalactiae, making
it a good candidate for vaccine development.
In this study, we constructed a chimeric GapC protein to
create a cross-reactive vaccine antigen that could be used for
protection against S. uberis, S. agalactiae, and S. dysgalactiae.
Tis chimeric protein was expressed on the cell surface of
Escherichia coli for production of large amounts of antigens
resulting in considerable savings in production costs and the
bacteria derived from these E. coli cells could serve as the
basis for the preparation of an efective vaccine against bovine
Streptococcus mastitis.
MATERIALS AND METHODS
Bacterial strains and culture media
During 2005-2008, 100 milk samples from 12 dairy farms
were collected from clinical bovine mastitis cases in the prov-
inces of Hebei, Hubei, and Heilongjiang, Tianjin Municipality,
and Inner Mongolia autonomous region of China based on
one isolate per herd. A total of 13 isolates were identifed as
Streptocossus by conventional microbiological methods includ-
ing gram stain, colony morphology, and coagulase test with
rabbit plasma, as well as species-specifc and ubiquitous DNA-
based assays reported by Todhunter et al. (3). Te confrmed
Streptocossus isolates were stored at -20
o
C in our laboratory. Te
biological property of thirteen isolates was listed in Table 1. E.
coli XLI strain was routinely cultured at 37
o
C in Luria-Bertani
medium (LB; Difco, BD, San Jose USA), Ampicillin (100 µg/
mL) or Carbenicillin (50 µg/mL) was added when needed (7).
PCR primers were described in Table 2, and the general PCR
method was carried out to detected gapC gene (23).
Construction of the gapC chimeric gene
Genomic DNA from S. agalactiae, S. dysgalactiae, and S.uberis
strain were purifed with a Nucleospin Tissue Kit (Clontech,
Palo Alto, CA,USA) with the addition of 5 U/mL lysozyme
(Sigma, St. Louis MO, USA) and used as a PCR template
(23). PCR reactions were carried out using specifc primers
(synthesized by Sangon Biotech, Shanghai, China) (Table 2).
Te PCR reaction contained 10 × Taq DNA polymerase
bufer with (NH
4
)
2
SO
4
2.5 µL, 2.5 mM dNTP 2 µL, 25 µM
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 Zhu, Z.B. 16
gapC forward primer 1 µL, 25 µM gapC reverse primer 1
µL, 25 mM MgCl
2
2 µL, Genomic DNA 1 µL, 5 U/µL Taq
DNA polymerase 0.20 µL, and ddH
2
O 15 µL with 20 µL of
the total volume. Te PCR conditions were as follows: initial
denaturation step at 95
o
C for 4 min; followed by 40 cycles
of 95
o
C for 1 min; 50
o
C for 1 min; 72
o
C, for min each; and
completed by incubation at 4
o
C for 1 h. All amplifed PCR
products were detected on 1% agarose gels electrophoresis
and stained with ethidium bromide. PCR products were
reclaimed and purifed using Biospin GeL Extraction Kit
(Bioer, Hangzhou, China) according to the manufacturer’s
instruction.
Te gene encoding the gapC chimera was constructed
as follows: the PCR fragment was digested with Bam HI
and Sal I. Te resultant 1005 bp fragment was cloned into
pQE-30 (Qiagen, Hilden, German), an E. coli expression
vector that adds a 6-histidine tag at the NH
2
terminus of the
GapC protein for purifcation by afnity chromatography.
Te resultant plasmids were named pQE-30-TR/GapC (S.
agalactiae gapC gene), pQE-30-WR/GapC (S. dysgalactiae
gapC gene), and pQE-30-RF/GapC (S.uberis gapC gene).
Te gapC chimeric gene was sequenced and analyzed (23).
Expression and purifcation of the GapC
Te expression and purifcation of CapC was carried out ac-
cording to the method of Brassard et al. (23). Te E. coli XLI
(Takara, Dalian, China) strain was used as a host for the clon-
ing and expression study. Prior to transformation, a CaCl
2
Table 1: Biochemical identifying features of Streptococcus Species
Bacteria Hippurate Esculin Mannitol Sorbierite Lactose Synanthrin Rafnose Trehalose Salicin 6.5%NaCl
7-2 + - - - + - - + + -
CH + - - - + - - + + -
10-2-1 + - - - + - - + + -
SD0309 + - - - + - - + + -
SD0303 + + + + + + - + + -
LS0312 - - - - + - - + + -
LS0351 - - - + + - - + - -
LS0311 + - - - + - - + + -
LS0303 + - - - + - - - - -
LS0313 - - - + + - - + + -
LS0341 + - - - + + + - - -
SD0306 + + + + + + - + - -
LS0302 - + - - + - + - - -
Table 2: Primers used in this study
Bacteria Sequence
a
PCR product sizes
S. agalactiae
F: 5’-GCTAGGCTCCATTGAATC-3’
R: 5’-TTAACCTAGTTTCTTTAAAACTAGAA-3’
162 bp
S. dysgalactiae
F: 5’-GAACACGTTAGGGTCGTC-3’
R: 5’-AGTATATCTTAACTAGAAAAACTATTG-3’
264 bp
S. uberis
F: 5’-TAAGGAACACGTTGGTTAAG-3’
R: 5’-TCCAGTCCTTAGACCTTCT-3’
451 bp
S. agalactiae
P1: 5′- CGCGGATCCATGGTAGTTAAAGTTGGTATT -3′
P2: 5′- GACGTCGACAGCGATTTTTGCAAAGTACTC -3′
1005 bP
S. dysgalactiae
P3: 5′- CGCGGATCCATGGTAGTTAAAGTTGGTATT -3′
P4: 5′- GACGTCGACAGCGATTTTTGCAAAATACTC -3′
1005 bP
S. uberis
P1: 5′- CGCGGATCCATGGTAGTTAAAGTTGGTATT -3′
P2: 5′- GACGTCGACAGCGATTTTTGCAAAGTACTC -3′
1005 bP
a
Te restriction enzyme sites (Bam HI and Sal I) used for the construction of the chimera are indicated using underline.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 17 Bovine Mastitis Vaccine
method (24) was carried out to prepare E. coli XLI competent
cell. Te resulting recombinant plasmids (pQE-30-TR/
GapC, pQE-30-WR/GapC, and pQE-30-RF/GapC) were
transformed into Escherichia coli XLI. A positive clone was
selected, inoculated into Luria Broth media containing
ampicillin BD, (San Jose USA), and induced with 1 mM
IPTG (isopropyl-β-D-thiogalactopyranoside) (Sigma, CA,
USA) at 37
o
C for 1-4 h. Te cells were centrifuged and the
pellet was resuspended in 5 mL 50 mM sodium phosphate
pH 8.0 containing 300 mM NaCl, 10 mM imidazole and 5
mg lysozyme, and then the whole mixture were incubated on
ice for 30 min. Te bacterial cells were disrupted by sonica-
tion on ice. Te lysate was centrifuged at 10,000 g for 30
min and the supernatant was saved for the purifcation of
the six-histidine (His
6
) tag fusion protein using Ni-NTA
His·bind
R
Resin purifcation system (Novagen, CA, USA)
according to the products guideline. Non-recombinant E.
coli XLI cells and non-induced recombinant clone were used
as negative controls.
SDS-PAGE and western blot analysis
SDS-PAGE and western blot analysis was carried out ac-
cording to the previous study (24). Bacterial lysates were
subjected to 12% gel of the SDS-PAGE protocol and
transferred to nitrocellulose membrane Hybond
TM
-C
(Amersham, Uppsala Sweden) as described previously (25).
Te primary antibody was mouse anti-Streptococcus polyclonal
antibody (1:1500 dilution, prepared in our laboratory) or
mouse anti-His
6
monoclonal antibody (1:2000 dilution,
Invitrogen, CA, USA). Horseradish peroxidase-conjugated
goat anti-mouse antibodies were used as the second antibody.
Te protein bands were visualized by 3, 3’-diaminobenzidine
(DAB, Zhongshan, Beijing, China) as recommended by the
manufacturer.
Determination of GAPDH activity
Te purifed protein (His
6
GAPDH) was assayed for
GAPDH activity according to the protocol of Brassard (23)
with some modifcations. Purifed protein (50 µL) was added
to 100 µL of 10 mM DL-glyceraldehyde-3-phosphate (DL-
GAP), 100 µL 10 mM NAD
+
and 750 µL of assay bufer (40
mM triethanolamine, 50 mM Na
2
HPO4, 0.2 mM EDTA, 20
mM 2-mercaptoethanol and 0.1% (v/v) Tween-20, pH 8.6).
Negative control assays were performed as above without the
addition of DL-GAP. Te reduction of NAD
+
to NADH
was monitored spectrophotometrically at optical density
(OD) 340 at 20 s intervals for 4 min using NovaspecII
(Pharmacia, CA, USA). Activity calculation was based on
a molar absorption coefcient of 6.22×10
-3
mol
-1
cm
-1
for
NADH at 340 nm. Protein concentration was determined
using a colorimetric Bradford assay (Bio-Rad, CA, USA).
Mice immunizations and immune assays
BALB/c mice (SPF, 4-6 weeks, 18-22 g, healthy) were pro-
vided by Experimental Animal Center, Harbin Veterinary
Research Institute, Te Chinese Academy of Agricultural
Sciences, China. Animal experiments were approved
by Ethics Committee of Experimental Animal Center,
Heilongjiang Bayi Agricultural University.
Te immune responses to the GapC proteins were
determined in Balb/c mice immunized with the purifed
GapC proteins. Proteins (10 mg dose) were emulsifed with
Freund Adjuvant Complete F5881 (Sigma, CA, USA) at
ratio of 1:1, and administered via the intramuscular route.
Te trial consisted of a total of seventy mice divided into
seven groups of ten each. Tree groups were immunized with
pQE-30-TR/GapC (Group 2), pQE-30-WR/GapC (Group
3) and pQE-30-RF/GapC (Group 4), respectively. A placebo
group (Group 1) immunized with PBS was included. Te
other groups consisted of immunized with killed S. agalactiae
(Group 5), S. dysgalactiae (Group 6) and S. uberis (Group
7). In all cases, frst vaccinations were carried out, and then
boosted after three weeks. Serum samples were collected at
days 0, 7, 14, 21, 28, 35, 42, 56 and tested by ELISA for the
presence of total IgG antibodies against the GapC proteins
using alkaline-phosphatase-conjugated polyclonal antibody
against mouse IgG. GapC proteins in serum were detected by
Western blot assays described above. A micro-agglutination
test utilizing S. agalactiae, S. dysgalactiae, S. uberisis as anti-
gen for detecting and measuring serum agglutinins against
bacteria were performed.
Lethal challenge
Two weeks after boosting, control and GapC-immunized
mice were intraperitoneally challenged using 100 µL lethal
dose of S. agalactiae LS0310, S. dysgalactiae LS0312 and S.
uberis SD0306, respectively. Te animals were monitored
three times a day. Once the animals displayed serious clini-
cal signs (moribund), they were euthanized and counted as
dead. Te animals that survived after challenge were sacrifced
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 Zhu, Z.B. 18
after a week post challenge. Surviving number of animals was
recorded for up to 7 successive days.
RESULTS
Construction of the chimeric gap gene
Based on the genome sequences of S. agalactiae, S. dysgalactiae
and S. uberis (Accession Nos. AF421899, AF375662 and
AF421900), PCR primers (Table 2) were designed to amplify
the gapC gene of a 1005 bp fragment (Fig. 1A) and these
fragments were cloned into the expression plasmid pQE-
30 to generate plasmid pQE-30-TR/GapC, pQE-30-WR/
GapC, and pQE-30-RF/GapC. As expected, the obtained
products could be cut with both Bam HI and Sac I, and
the fragments of the expected size (1005 bp) were detected
(Fig. 1B). Sequencing of the insert in pQE-30-TR/GapC,
pQE-30-WR/GapC, and pQE-30-RF/GapC revealed the
presence of a 1005 bp open-reading frame (ORF) encod-
ing a putative protein of 335 amino acids with a predicted
molecular weight of 38 KDa. A BLAST search of the protein
indicated that S. agalactiae (pQE-30-TR/GapC) shared 97%
homology with the GapC proteins of the reference strain,
with changes being Ala 104→Gly, Ala 105 deletion, Ala
112→Glu, Val 187→Ile, Ala 203→Gly, Ala 177→Pro, Ala
322→Ser in the protein. S. dysgalactiae (pQE-30-WR/GapC)
and S. uberis (pQE-30-RF/GapC) shared 100% homology
with the GapC proteins of the reference strains, although 2
and 39 changes of nucleic acids, respectively, were present.
SDS-PAGE and Western Blot
All the recombinant GapC proteins were expressed as
6-histadine-tagged fusion proteins in E. coli XLI host cells.
Te gapC chimeric gene was cloned in front of a histidine
tag for purifcation. Analysis of the purifed, recombinant
6-histadine GapC proteins by SDS-PAGE indicated mo-
lecular weight of 38 kDa (Fig. 2A), which closely matches the
predicted molecular weight based on predicted fusion protein
sequences. Te resultant protein reacted with a monoclonal
antibody against the histidine tag, a polyclonal antibody
against GapC (Fig. 2B). Tis protein was purifed and used
in vaccination trials as described below.
GAPDH activity
Te mastitis-causing S. agalactiae, S. dysgalactiae and S. uberis
encodes GapC, a surface-exposed protein with GAPDH
activity (6). To compare the enzymatic activities of the
various GAPDH isoforms in the purifed GapC protein and
bacteria, we examined dynamic catalysis during a 1 minute
time frame. Our data revealed no activity was detected for
GapC in the control trial. GapC encoded by pQE-30-TR/
GapC (0.358), pQE-30-WR/GapC (0.320), and pQE-30-
RF/GapC (0.324) were signifcantly higher (P<0.05) than
the S. agalactiae (0.120), S. dysgalactiae (0.107), and S.uberis
(0.116) (Figure 3).
Humoral immune responses to the GapC
In order to verify whether the recombinant GapC protein
could simultaneously induce strong humoral responses
against bacteria, mice were immunized with the recombinant
proteins and their immune responses to the three proteins
were determined with ELISA by measuring total IgG in
serum at one week intervals; the results were presented in
Figure 1: Amplifcation and cloning of gapC gene. (A) Te gapC gene
was amplifed by PCR (1005 bp). Lane M: DNA Marker DL2K plus
(Transgen, Beijing, China); lanes 1-3: pQE-30-RF/GapC, pQE-30-
WR/GapC, and pQE-30-TR/GapC. (B) Recombinant plasmid was
identifed with Sal I and Hind III (2500 bp and 1005 bp) digestion.
Lane M: DNA Marker DL2K plus; lane 1-3: pQE-30-RF/GapC,
pQE-30-WR/GapC, and pQE-30-TR/GapC.
Figure 2: SDS-PAGE and Western blotting analysis of the
recombinant protein. (A) Lane 1: pQE-30-RF/GapC; Lane 2:
pQE-30-WR/GapC; Lane 3: pQE-30-TR/GapC, Lane 4: Control,
and Lane 5: purifed GapC protein. (B) Lane 1, 3 and 5: Control,
Lane 2: pQE-30-RF/GapC; Lane4: pQE-30-WR/GapC; Lane6:
pQE-30-TR/GapC.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 19 Bovine Mastitis Vaccine
Table 3. Compared to the control group, the GapC-specifc
total IgG serum titers increased signifcantly in mice im-
munized with GapC (P<0.001). Preliminary vaccination
induced signifcant increase of antibody, and after boosting
for two weeks, the antibody titer reached the highest level of
1:128000, 1:64000, and 1:128000, respectively. Tereafter it
fell back slowly until day 56.
A weak but signifcant (p<0.01) cross-immune response
to GapC was observed in mice for S. agalactiae , S. dysgalactiae,
and S. uberis (data not shown). Tese results indicated that
the recombinant protein simultaneously induced high levels
of predefned cross-reacting GapC antibodies. All immune
sera produced with the GapC-immunized rabbits reacted
with the three above mentioned strains. Te agglutination
potency was found to be greater than 2
11
(Table 4), and cross
agglutination was observed, which implied there probably
existed common agglutination antigens.
Immunoprotection
In general it was evaluated that the GapC product may be
successfully used in a vaccine trial. Te goal of this research
was to investigate the immune responses to GapC proteins of
Streptococcus to the response obtained with the gapC chimera.
Te protective efcacy of the GapC was evaluated in terms
of survival numbers. As shown in Table 5, none of challenged
control animals survived in each experiment after a week
post-challenge. In comparison to the control, more than 3
animals immunized with GapC survived after challenge,
indicating the immune protective potential of GapC.
DISCUSSION
Figure 3: GAPDH activity analysis of the recombinant pQE-30-TR/
GapC, pQE-30-WR/GapC, and pQE-30-RF/GapC protein.
Table 3: Antibody IgG titres of recombinant GapC protein in
immunized serums
Days pQE-30-TR/
GapC
pQE-30-WR/
GapC
pQE-30-RF/
GapC
0 0 0 0
7 1:2000 1:2000 1:1000
14 1:8000 1:4000 1:4000
21 1:16000 1:8000 1:8000
28 1:32000 1:16000 1:16000
35 1:64000 1:32000 1:64000
42 1:128000 1:64000 1:128000
49 1:128000 1:64000 1:64000
56 1:64000 1:32000 1:64000
Table 4: Agglutination potency in immunized serums
Groups Agglutination antigen Value
pQE-30-TR/GapC
LS-10-1 2
11
LS-12-2 >2
12
SD-6 >2
12
pQE-30-WR/GapC
LS-10-1 >2
12
LS-12-2 >2
12
SD-6 2
11
pQE-30-RF/GapC
LS-10-1 >2
12
LS-12-2 2
12
SD-6 >2
12
Table 5: Protection from S. agalactiae, S. dysgalactiae, S. uberis challenge
Group Strains Survival number Immunoprotection
Control
LS-10-1 0/10 0%
SD-6 0/10 0%
LS-12-2 0/10 0%
pQE-30-TR/
GapC
LS-10-1 7/10 70%
SD-6 7/10 70%
LS-12-2 8/10 80%
pQE-30-WR/
GapC
LS-10-1 8/10 80%
SD-6 9/10 90%
LS-12-2 10/10 100%
pQE-30-RF/
GapC
LS-10-1 6/10 60%
SD-6 9/10 90%
LS-12-2 7/10 70%
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 Zhu, Z.B. 20
Mastitis caused by Streptococcus remains one of the more
costly diseases for dairy farmers. Although antibiotic
therapy and culling of infected animals are the most efec-
tive approaches to control of the disease, the success rate of
treatment against Streptococcus infections varies considerably.
When the treatment costs and losses due to reduced milk
production, discarding of the milk and culling of the animals
are calculated, it is clear that new approaches such as vaccina-
tion are needed to control the disease. In the last few years,
it has been proposed that immunization with recombinant
proteins might be a viable alternative to the more tradi-
tional approach of using whole cell lysates as the antigenic
component of a vaccine (6, 25). With a view to identifying
cross-protective protein antigens for use as potential vaccines
against mastitis-causing Streptococci, we have found that the
pathogenic Streptococci S. dysgalactiae, S. uberis and S. aga-
lactiae all possess cell wall-associated GapC. Terefore, the
objective of the present study was to compare the quantity
and quality of the immune response to Streptococci antigens
encoded by gapC gene.
Te outer bacterial surface proteins play an important
role in transport of nutrients, cellular metabolism as well as
virulence-related functions such as evasion of host defenses,
adhesion and invasion (26). Te families of proteins with
GAPDH activity are conserved at the DNA and protein
sequence level and have been shown to be potential com-
ponents of vaccines against a variety of bacterial, mycotic,
and parasitic infections (6, 7, 27). We initiated this work by
constructing plasmids encoding the GapC of S. dysgalactiae,
S. uberis and S. agalactiae, respectively. Tree protein chimeras
were constructed by PCR amplifcation of the gapC genes
of mastitis-isolates of S. agalactiae, S. dysgalactiae, S. uberisis
followed by tandem ligation of the PCR products. Ten we
characterized gapC, the gene encoding for the 38 kDa protein
GAPDH. Te 6-histidine tag GapC was purifed and used to
determine whether its previously observed protective capacity
against S. dysgalactiae, S. uberis and S. agalactiae infection,
would also result in cross-species protection due to the more
than 98% homology observed between the three proteins.
Te nucleotide sequence for gapC was determined and an
open reading frame of 1005 bp was identifed. Te nucleo-
tide sequence homologies showed that the GapC shares a
degree of identity with GAPDH of other Streptococci. Te
amino acid sequence seemed to be conserved among these
Streptococci. Te GapC exhibited a signifcant similarity to
the GAPDH of S. agalactiae (97%), S. dysgalactiae (100%)
and S. uberis (100%), respectively. Te protein was expressed
in E. coli and it reacted to specifc GapC antisera. In addi-
tion, relatively high levels of GAPDH activity in comparison
with the non-recombinant protein have been found in the
soluble protein fraction after sonication of cells (23). Similar
values have been obtained when using gentler cell disruption
methods (i.e. homogenization with a Sorvall blender or a
Potter-Elvehjem device), whereas no measurable activity was
found associated with the non-recombinant protein obtained
after centrifugation, which supported the evidence that all
the GAPDH was located in the purifed proteins, as was later
confrmed by immunological studies.
Previous work has shown that vaccination of dairy cows
against mastitis pathogens can result in a rapid and intense
infammatory and immune response (6). In addition, a previ-
ous study showed that vaccination of mice and rats with a 22
aa B cell epitopic region of S. mansoni GAPDH resulted in
partial protection against challenge with S. mansoni (28), sug-
gesting that BALB/c mice are a good model for investigating
the vaccine and the signifcance of the humoral antibodies
in the protection against infection. Most animal vaccines
employ killed bacterial cells, or crude mixtures of proteins
to elicit protection, however, in this study we have used a
defned subunit vaccine to elicit greater protection than has
been observed in previous trials (29-31).
We frstly detected expression of recombinant GapC
in transformed cells (Fig. 2), and we observed signifcant
humoral and very low cell-mediated immune responses.
We further test if an additional boost with the recombi-
nant proteins would enhance the quality and quantity of
the immune responses in mice. Two weeks after boosting,
GapC-immunized mice were challenged and more than
3 animals immunized with GapC survived indicating the
immunoprotective potential of GapC. Vaccination with
6-histidine tag GapC resulted in cross protection against
mastitis. Tis may be because the 6-histidine tag GapC is
as protective as that of S. uberis, because of its sharing the
98% similarity.
In conclusion, we showed that the Streptococcus GapC
protein is important for establishment of humoral immunity.
Tis observation together with previous studies conducted in
our laboratory on GAPDH proteins of Staphylococcus aureus
makes this protein an important target for vaccine develop-
ment against bovine mastitis.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 21 Bovine Mastitis Vaccine
ACKNOWLEDGEMENTS
Tis study was supported by Science and Technology Project
for Heilongjiang Agricultural Reclamation Administration
(HNK11A-08-01-04), Technology Research Foundation of
Education Department of HeiLongJiang Province, China
(12541578 and 11541251).
REFERENCES
1. Kossaibati, M.A. and Esslemont, R.J.: Te costs of production
diseases in dairy herds in England. Vet. J. 154: 41-51, 1997.
2. Erskine, R.J., Bartlett, P.C., Johnson, G.L. and Halbert, L.W.:
Intramuscular administration of ceftiofur sodium versus in-
tramammary infusion of penicillin novobiocin for treatment of
Streptococcus agalactiae mastitis in dairy cows. J. Am. Vet. Med.
Assoc. 208: 258-260, 1996.
3. Todhunter, D.A., Smith, K.L. and Hogan, J.S.: Environmental
streptococcal intramammary infections of the bovine mammary
gland. J. Dairy Sci. 78: 2366-2374, 1995.
4. Bramley, A.J.: Sources of Streptococcus-Uberis in the Dairy-Herd
.1. Isolation from Bovine feces and from straw bedding of cattle.
J. Dairy Res. 49: 369-373, 1982.
5. Kruze, J. and Bramley, A.J.: Sources of Streptococcus uberis in the
dairy-herd .2. Evidence of Colonization of the Bovine Intestine
by Str-Uberis. J. Dairy Res. 49: 375-379, 1982.
6. Fontaine, M.C., Perez-Casal, J., Song, X.M., Shelford, J., Willson,
P.J. and Potter, A.A.: Immunisation of dairy cattle with recom-
binant Streptococcus uberis GapC or a chimeric CAMP antigen
confers protection against heterologous bacterial challenge. Vac-
cine. 20: 2278-2286, 2002.
7. Bolton, A., Song, X.M., Willson, P., Fontaine, M.C., Potter, A.A.
and Perez-Casal, J.: Use of the surface proteins GapC and Mig of
Streptococcus dysgalactiae as potential protective antigens against
bovine mastitis. Can. J. Microbiol. 50: 423-432, 2004.
8. Song, X.M., Perez-Casal, J., Fontaine, M.C. and Potter, A.A.:
Bovine immunoglobulin A (IgA)-binding activities of the surface-
expressed Mig protein of Streptococcus dysgalactiae. Microbiol-Sgm.
148: 2055-2064, 2002.
9. Stalhammarcarlemalm, M., Stenberg, L. and Lindahl, G.: Protein
Rib - a novel Group-B streptococcal cell-surface protein that con-
fers protective immunity and is expressed by most strains causing
invasive infections. J. Exp. Med. 177: 1593-1603, 1993.
10. Wibawan, I.W.T. and Lammler, C.: Properties of Group-B Strep-
tococci with protein surface antigen-X and antigen-R. J. Clin.
Microbiol. 28: 2834-2836, 1990.
11. Wibawan, I.W.T., Lammler, C., Seleim, R.S. and Pasaribu, F.H.: A
hemagglutinating adhesin of Group-B streptococci isolated from
cases of bovine mastitis mediates adherence to Hela-Cells. J. Gen.
Microbiol. 139: 2173-2178, 1993.
12. Spellerberg, B., Rozdzinski, E., Martin, S., Weber-Heynemann,
J., Schnitzler, N., Lutticken, R. and Podbielski, A.: Lmb, a protein
with similarities to the LraI adhesin family, mediates attachment
of Streptococcus agalactiae to human laminin. Infect. Immun. 67:
871-878, 1999.
13. Ruhlmann, J., Wittmannliebold, B., Jurgens, D. and Fehrenbach,
F.J.: Complete amino-acid sequence of Protein-B. Febs Lett. 235:
262-266, 1988.
14. Almeida, R.A., and Oliver, S.P.: Antiphagocytic Efect of the Cap-
sule of Streptococcus-Uberis. J. Vet. Med B. 40: 707-714, 1993.
15. Oliver, S.P., Almeida, R.A. and Calvinho, L.F.: Virulence factors
of Streptococcus uberis isolated from cows with mastitis. J. Vet.
Med. B. 45: 461-471, 1998.
16. Song, X.M., Perez-Casal, J., Bolton, A.., and Potter, A.A.: Surface-
expressed mig protein protects Streptococcus dysgalactiae against
phagocytosis by bovine neutrophils. Infect. Immun. 69: 6030-6037,
2001.
17. Leigh, J.A., Field, T.R. and Williams, M.R.: Two Strains of Strep-
tococcus uberis, of difering ability to cause clinical mastitis, difer
in their ability to resist some host defense factors. Res Vet. Sci.
49: 85-87, 1990.
18. Schaufuss, P., Sting, R., Schaeg, W. and Blobel, H.: Isolation and
characterization of hyaluronidase from Streptococcus uberis. Zbl
Bakt-Int. J. Med. M. 271: 46-53, 1989.
19. Lottenberg, R., Broder, C.C., Boyle, M.D., Kain, S.J., Schroeder,
B.L. and Curtiss, R.: Cloning, sequence analysis, and expression
in E.coli of a streptococcal plasma receptor. J. Bacteriol. 174: 5204-
5210, 1992.
20. Pancholi, V., and Fischetti, V.A.: A major surface protein on
Group-A streptococci is a glyceraldehyde-3-phosphate-dehydro-
genase with multiple binding-activity. J. Exp. Med. 176: 415-426,
1992.
21. Pancholi, V. and Fischetti, V.A.: Glyceraldehyde-3-phosphate
dehydrogenase on the surface of group-a streptococci is also an
adp-ribosylating enzyme. P. Natl. Acad. Sci. USA. 90: 8154-8158,
1993.
22. Zhu, H.W., Zhu, Z.B., Cui, Y.D., Zhang, J., Liu, L.F. and Piao,
F.Z.: GAPDH activity and immunogenicity of Staphylococcus
aureus recombinant GapC protein. Chin. J. Biotech. 24: 754-759,
2008.
23. Brassard, J., Gottschalk, M. and Quessy, S.: Cloning and purifca-
tion of the Streptococcus suis serotype 2 glyceraldehyde-3-phosphate
dehydrogenase and its involvement as an adhesin. Vet. Microbiol.
102: 87-94, 2004.
24. Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular cloning:
a laboratory manual, 2nd edition. Cold spring harbor laboratory
press, Cold spring harbor, NY. 2001.
25. Ma, J.Z., Cui, Y.D., Zhang, J., Zhu, Z.B. and Piao, F.Z.: Cloning
and expression of Staphylococcus aureus surface protein Isdb and
its immune experiment in mice. Chin. J. Biotech. 27: 566-571,
2011.
26. Kerro-Dego, O., Prysliak, T., Perez-Casal, J. and Potter, A.A.:
Role of GapC in the pathogenesis of Staphylococcus aureus. Vet.
Microbiol. 156: 443-447, 2012.
27. Rosinha, G.M.S., Myioshi, A., Azevedo, V., Splitter, G.A. and
Oliveira, S.C.: Molecular and immunological characterisation of
recombinant Brucella abortus glyceraldehyde-3-phosphate-dehy-
drogenase, a T- and B-cell reactive protein that induces partial pro-
tection when co-administered with an interleukin-12-expressing
plasmid in a DNA vaccine formulation. J. Med. Microbiol. 51:
661-671, 2002.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (2)  June 2015 Zhu, Z.B. 22
28. Argiro, L.L., Kohlstadt, S.S., Henri, S.S., Dessein, H.H., Matabiau,
V.V., Paris, P.P., Bourgois, A.A. and Dessein, A.J.: Identifcation
of a candidate vaccine peptide on the 37 kDa Schistosoma mansoni
GAPDH. 18: 2039-48, 2000.
29. Finch, J.M., Hill, A.W., Field, T.R. and Leigh, J.A.: Local Vac-
cination with Killed Streptococcus-Uberis protects the bovine
mammary-gland against experimental intramammary challenge
with the homologous strain. Infect. Immun. 62: 3599-3603,
1994.
30. Finch, J.M., Winter, A., Walton, A.W. and Leigh, J.A.: Further
studies on the efcacy of a live vaccine against mastitis caused by
Streptococcus uberis. Vaccine. 15: 1138-1143, 1997.
31. Leigh, J.A., Finch, J.M., Field, T.R., Real, N.C., Winter, A.,
Walton, A.W. and Hodgkinson, S.M.: Vaccination with the plas-
minogen activator from Streptococcus uberis induces an inhibitory
response and protects against experimental infection in the dairy
cow. Vaccine. 17: 851-857, 1999.
Research Articles