Embedded Scribd iPaper - Requires Javascript and Flash Player

Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 15 Virulence Genes of Enterococcus faecalis
Investigation of Virulence Genes of Enterococcus faecalis Strains
Isolated from Mastitic Bovine Milk
Yildiz, O.
1
and Turkyilmaz, S.
2
*
1
Health Sciences Institute, Adnan Menderes University, Aydin, Turkey.
2
Department of Microbiology, Faculty of Veterinary Medicine, Adnan Menderes University, Aydin, Turkey.
*
Corresponding Author: Dr. Suheyla Turkyilmaz, Adnan Menderes University, Faculty of Veterinary Medicine, 09016 Aydin, Turkey. Tel: +90 2562470700.
E-mail: sturkyilmaz@adu.edu.tr
ABSTRACT
In this study it was aimed to investigate the potential virulence genes (gelatinase [gelE]), adhesion-associated
protein [EfaAfs], enterococcal surface protein [esp], cytolysins [cylA, cylM, cylB], sex pheromones [cpd, cob,
ccf], aggregation substance [aggA], enhanced expression of pheromone [eep]) of Enterococcus faecalis strains
isolated from mastitic bovine milk samples with polymerase chain reaction (PCR). A total of 56 E. faecalis
isolates, which were isolated from 600 bovine mastitic milk samples, were used as material. After the isolation
of enterococci in selective media, identifcation based on genus and species were also performed using PCR.
Later, the E. faecalis isolates were tested for the presence of eleven virulence factors. Te efaAfs gene was
the predominant (94.6%) virulence gene among the enterococci investigated followed by cpd (91.0%), gelE
(87.5%), esp (51.7%), ccf (42.8%), cob (10.7%), eep (8.9%), aggA (7.1%), cylA and cylM (1.8%). cylB gene were
not detected in any of isolates. 1.8% and 3.6% of the strains harboured eight and seven virulence determinants,
while there was no isolate having no virulence genes. Studies on the prevalence of enterococci in dairy cattle
have been reported however there is still a lack of information regarding virulence genes of enterococci
isolated from mastitic bovine milk. To the best knowledge of the authors this is the frst report describing
virulence genes of E. faecalis isolated from bovine mastitic milk in Turkey. It was concluded that E. faecalis
strains isolated from mastitic bovine milk were found to be highly pathogenic with potential risk factors for
consumer health. Further epidemiological studies are necessary to investigate the status of virulence factors
of other enterococci isolated from mastitic bovine milk in the veterinary feld.
Keywords: Enterococcus faecalis; Virulence Genes; Bovine Mastitis
INTRODUCTION
Enterococcus faecalis is a Gram-positive bacterium that in-
habits the oral cavity and gastrointestinal fora of humans
and animals. Although enterococci are ubiquitous in nature
as normal commensals they are also of medical importance.
Enterococci are a leading cause of nosocomial infections in
humans (1) and have been associated with bovine mastitis in
dairy cattle (2). Little information is available on enterococcal
pathogens isolated from mastitic milk samples (2), and if any,
most studies focus on isolation and identifcation of major
species (3).
Tough enterococci as opportunistic pathogens do not
have strong virulence factors comparing with more viru-
lent bacteria, several factors conferring enhanced virulence
have been identifed in E. faecalis (3). A number of genes
encoding for virulence factors in E. faecalis strains includ-
ing adhesion-associated protein (efaAfs), sex pheromones
(cpd, cob, ccf ), gelatinase (gelE), enterococcal surface protein
(esp), enhanced expression of pheromone (eep), aggregation
substance (aggA), cytolysins (cylA, cylB, cylM) have been
described (4, 5). Te gelE gene encodes for an extracellular
Zn-metalloendopeptidase that is capable of hydrolysing
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 Yildiz, O. 16
gelatin, collagen, casein, hemoglobin and other biological
peptides (1). Te other virulence genes are represented by
efaAfs, cell wall adhesins expressed in serum in E. faecalis (6).
Te enterococcal surface protein esp gene has a large surface
protein with high molecular weight of unknown function
whose presence is increased in frequency among infection
arising from E. faecalis isolates (5, 7). Sex pheromones (cpd,
cob, ccf ) are chemotactic for human leukocytes and facilitate
conjugation (8). eep (enhanced expression of pheromone)
gene does not contain the pheromone sequence but is neces-
sary for pheromone expression and is a membrane protein
of E. faecalis (4). Aggregation substances encoded by aggA
are responsible for increased bacterial adhesion to eukaryotic
cells (9). Te cytolysins (cylA, cylM, cylB) lyse a broad range of
eukaryotic and prokaryotic cells and enhances the E. faecalis
virulence (10).
Studies on the prevalence of enterococci in dairy cattle
have been reported worldwide (11-13) as well as in Turkey
(14, 15). However, little information is available on entero-
coccal virulence genes, and if any, most studies focus on the
three major origins; medical, environmental or food isolates,
in the world (3, 5) as well as in Turkey (16).
To the best of our knowledge, this is the frst report about
virulence genes in E. faecalis of isolated from bovine mastitic
milk in Turkey. In this study, it was aimed to investigate the
potential virulence genes (efaAfs, cpd, cob, ccf, gelE, esp, aggA,
eep, cylA, cylM, cylB,) of E. faecalis strains isolated from mastitic
bovine milk samples with polymerase chain reaction (PCR).
MATERIALS AND METHODS
Bacterial strains
A total of 242 dairy cattle at 38 dairy farms were investigated
and 600 milk samples were obtained with mastitis (clinical
or subclinical). Te milk samples were from family farms in
Aydin region. Aydin is a county of 8007 km
2
situated along
the Aegean Sea on the western part of Turkey.
Diagnosis of mastitis
Clinical mastitis was diagnosed by changes in the udder
and milk by veterinary practitioners. Changes in the udder
included pain, swelling, warmth and abnormal appearance
(blood tinged milk, watery secretions, clots, pus) of milk.
Cows that did not have clinical mastitis were subjected
to further investigation for subclinical mastitis by using
California Mastitis Test. Te procedures and interpretations
have been described previously (17). For collection of milk
samples, teat ends were cleaned using 70% alcohol moist-
ened swabs and allowed to dry. After discarding the frst
few streams, 2-5 ml of the milk samples were collected into
sterile 5 ml glass fasks.
Identifcation of enterococci
Ten µl of milk was transferred in 5 ml Chromocult
Enterococci Broth (Merck, Germany) and incubated for 48
h 37°C for selective enrichment of the enterococci. Positive
cultures (a strong blue-green colour of the broth indicated the
presence of enterococci) were transferred to Enterococcosel
Agar (Becton Dickinson, Germany) for selective isolation.
Plates were incubated overnight at 37ºC. One presumptive
(small, translucent with brownish-black to black zones)
colony was passed to blood agar. Bacteria were identifed
by standard methods using morphological and biochemical
characteristics (17). All isolates were stored at -80°C in Brain
Heart Infusion Broth (Oxoid, UK) with 20% glycerol until
use for molecular confrmation.
DNA extraction
For genomic DNA from individual pure culture isolates were
extracted with InstaGeneTM DNA extraction kits (Bio-Rad,
Brazil) according to the manufacturer’s instructions. DNA
sample concentrations were determined by spectrophotom-
etry at the wave length of 260 nm and 280 nm.
Detection of Enterococci, E. faecalis and virulence genes
Te enterococcus suspect colonies were confrmed geneti-
cally using genus (18) and species specifc PCR (19). Uniplex
PCR was used for detection of EfaAfs, cpd, cob, ccf, gelE,
cylA, cylM, cylB, aggA (5), esp (7), eep (20) genes. All primers
(Macrogen, Holland) used in this work are listed in Table 1.
All the PCR reactions were carried out in a fnal volume of
20 µl containing 1X PCR bufer, 2 mM MgCl
2
, 200 mM
each of the four dNTPs (Fermentas, USA), 0.5 mM of each
primer and 1.25 units of Taq DNA polymerase (Fermentas,
USA). PCR conditions are given in Table 2. Reference
strains E. faecalis ATCC 29212 (gelE+, EfaAfs+, cpd+, cob+,
cylA+, cylM+, cylB+, ccf+, eep+) were used as positive controls
(21) and Escherichia coli ATCC 25922 was used as negative
control strain. Te positive control strains for genes of esp
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 17 Virulence Genes of Enterococcus faecalis
and aggA could not be obtained and for this study esp and
aggA positive PCR amplicon was sequenced by a private
company (Macrogen, Holland). Te amplifcation products
were analysed by electrophoresis on 1.5% agarose gel at 100
V for 30 min in Tris-acetate-EDTA bufer and revealed in
ethidium bromide (20 µg/ml).
RESULTS
Isolation and identifcation
A total of 600 milk samples were taken from 38 farms
and tested for presence of enterococci. Among samples
tested a total of 96 (16.0%) Enterococcus spp. were detected
biochemically.
Table 1: Oligonucleotide primers used to in the study
Primer Sequence (5’-3’) Amplicon size (bp) Reference
1 Ent1
Ent2
TACTGACAAACCATTCATGATG
AACTTCGTCACCAACGCGAAC
112 (18)
2 DDF
DDR
CACCTGAAGAAACAGGC
ATGGCTACTTCAATTTCACG
475 (19)
3 gelEF
gelER
ACCCCGTATCATTGGTTT
ACGCATTGCTTTTCCATC
419 (5)
4 cylAF
cylAR
TGGATGATAGTGATAGGAAGT
TCTACAGTAAATCTTTCGTCA
517 (5)
5 ccfF
ccfR
GGGAATTGAGTAGTGAAGAAG
AGCCGCTAAAATCGGTAAAAT
543 (5)
6 efaAfsF
efaAfsR
GACAGACCCTCACGAATA
AGTTCATCATGCTGCTGTAGTA
705 (5)
7 cylMF
cylMR
CTGATGGAAAGAAGATAGTAT
TGAGTTGGTCTGATTACATTT
742 (5)
8 cpdF
cpdR
TGGTGGGTTATTTTTCAATTC
TACGGCTCTGGCTTACTA
782 (5)
9 cylBF
cylBR
ATTCCTACCTATGTTCTGTTA
AATAAACTCTTCTTTTCCAAC
843 (5)
10 espF
espR
TTGCTAATGCTAGTCCACGACC
GCGTCAACACTTGCATTGCCGAA
933 (7)
11 eepF
eepR
GAGCGGGTATTTTAGTTCGT
TACTCCAGCATTGGATGCT
937 (20)
12 cobF
cobR
AACATTCAGCAAACAAAGC
TTGTCATAAAGAGTGGTCAT
1405 (5)
13 aggAF
aggAR
AAGAAAAAGTAGACCAAC
AACGGCAAGACAAGTAAATA
1553 (5)
Table 2: PCR conditions for the detection of virulence genes, Enterococcus sp. and E. faecalis strains.
Action
PCR
1
PCR
2
Temperature
(°C)
Duration
(min) Cycle
Temperature
(°C)
Duration
(min) Cycle
Initial denaturation 95 5 1 95 5 1
Denaturation 95 0.5
30
95 0.5
30
Annealing 53 0.5 57 0.5
Extension 72 1 72 1
Elongation 72 15 1 72 15 1
Cooling 4 infnite 4 infnite
1
Enterococcus sp., E. faecalis, gelE, cylA, ccf, EfaAfs, cylM, cpd, cylB, eep, cob
2
esp, aggA
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 Yildiz, O. 18
PCR
Of these 96 isolates, all of them were Enterococcus spp. PCR
positive (Figure 1) and of these 56 samples (58.3%) were E.
faecalis isolates (Figure 2).
Te E. faecalis isolates were tested for the presence of
eleven virulence genes. Te cylB genes were not detected in
any of the isolates. Te frequency of the other ten virulence
genes ranged in prevalence from 1.8% cytolysins (cylA and
cylM) to 94.6% (efaAfs). Te efaAfs gene was the most
widespread virulence determinant. Te second most fre-
quently occurring virulence gene, cpd, was found in 91.0%
the enterococci investigated followed by 87.5% (gelE),
51.7% (esp), 42.8% (ccf ), 10.7% (cob), 8,9% (eep), 7.1%
(aggA). Furthermore, multiple virulence genes co-existed
in the E. faecalis isolates. One (1.8%) and two (3.6%) of the
strains harboured eight and seven virulence determinants.
All the isolates were carrying at least one virulence gene
(Figure 3). Te distribution of virulence genes is presented
in Figure 4.
DISCUSSION
In this study, we have evaluated E. faecalis strains isolated
from bovine milk and their presence of virulence genes was
investigated by PCR. Enterococci can cause many economi-
Figure 1: PCR detection of Enterococcus spp. isolated strains 1-6: Enterococcus sp. feld isolates 7: Positive control (E. faecalis ATCC 29212)
8: Negative control (E. coli ATCC 25922) M: 100 bp DNA ladder.
Figure 2: PCR detection of isolated E. faecalis strains 1-2: E. faecalis feld isolates 3: Positive control (E. faecalis ATCC 29212) 4: Negative control
(E. coli ATCC 25922) M: 100 bp DNA ladder.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 19 Virulence Genes of Enterococcus faecalis
cally important animal diseases including bovine mastitis (2)
and little information is available on enterococcal pathogens
isolated from milk samples. In cases of mastitis where a
causative agent has been identifed, 0–21.2% of those was
reportedly caused by enterococci (11, 13-15). Enterococcus
spp. were isolated in 16% in the study. When we analysed
the enterococci by species, E. faealis was found to be the
most prominent species. Tese results were similar to other
studies in which E. faecalis was reported as the most common
isolated species (12, 16).
In this study, presence of virulence genes that encode
EfaAfs, cpd, cob, ccf, gelE, esp, aggA, eep cylA, cylM, cylB, was
investigated by PCR. Te adhesion-associated protein EfaAfs
was present in 94.6% of all our isolates. Tis gene has been
associated with endocarditis and is suspected to be involved
in the surface adhesion mechanism in enterococci, and in
Figure 3: PCR detection of virulens genes. 1. gelE 2. cylA 3. ccf 4. EfaAfs 5. cylM 6. cpd 7. cylB (Positive control strain E. faecalis ATCC 29212)
8. esp 9. eep 10. cob 11. aggA gene positive isolates 12. Negative control (E. coli ATCC 25922) M: 100 bp DNA ladder.
Figure 4: Te distribution of virulence genes in E. faecalis strains isolated of mastitic bovine milk.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 Yildiz, O. 20
immune system evasion (6, 22). For EfaAfs, this was in agree-
ment with a preceding study in which the gene was always
found in medical E. faecalis isolates (5, 20, 22), whereas the
majority (89%) of E. faecalis strains were found in food (5).
Sex pheromone genes (cpd, ccf, cob) and sex pheromone-
related genes (agg, eep) are considered virulence determinants
(23). While these genes are responsible for the conjugative
transfer of sex pheromones plasmids, they can also be
involved in the pathogenicity process as well. Among the
sex pheromone genes in the study, cpd was the gene which
had the highest frequency among the E. faecalis in our
isolates, followed by ccf and cob. Previous studies reported
frequent detection of these three sex pheromone genes in
E. faecalis strains of various origins (5, 16, 22, 23). Both sex
pheromone-related genes eep (coding for a protein enhanc-
ing the expression of pheromones) and aggA (coding for
the aggregation substance) were detected in 8.9% and 7.1%
in our isolates respectively. To the best of our knowledge, a
few study examined the frequency of eep among E. faecalis,
revealing that eep was present in more than half of clinical
and environmental isolates (20, 21). Te information related
to the contribution of this virulence determinant is limited,
but it may play a role in cow mastitis (24). Previous studies
do not agree on the frequency of aggA among enterococci.
Some studies have shown aggA in a high proportion among
E. faecalis isolates from food and clinical origin (5, 23). In
some of sex pheromone genes’ positive strains, the aggA gene
were also present (5).
Te gelE gene, coding for an extracellular gelatinase, was
also found to occur among mastitic bovine milk E. faecalis
isolates in the study. Tis gene has been found previously
in water, but also in food isolates (5, 20, 21, 25). Te esp
genes have been associated with urinary tract infections (15,
20). Te esp gene has also been shown to occur with varying
frequency in enterococci from other sources such as clinical,
food and the environmental samples (5, 7, 22).
In the present study, frequency of cytolysin genes (cylA,
cylM, and cylB) was low (1.8%, 1.8%, 0.0%, respectively). In
a previous study (21), only 7 of 1558 isolates (0.4%) carried
cylABM in environmental isolates. Te frequency of the cylA
gene among enterococci is highly variable and does not cor-
relate with clinical or food isolates (25).
In conclusion, E. faecalis was the major enterococci spe-
cies isolated from mastitic bovine milk samples in western
of Turkey. Our results demonstrate that genes coding for
adhesion-associated protein, sex pheromones, gelatinase, en-
terococcal surface protein, enhanced expression of pheromone
and aggregation substance can also occur in a high propor-
tion of mastitic bovine milk isolates. Te presence of these
virulence determinants in E. faecalis strains may be signifcant
in the evolution of pathogenic strains.
Te fndings of this study suggest that milk origin strains
of E. faecalis may be potential risk factors for consumer health
in terms of virulence genes. More detailed studies should be
performed to investigate the status of virulence factors of
other enterococci isolated from mastitic bovine milk in the
veterinary feld.
ACKNOWLEDGEMENTS
Tis manuscript was prepared from the frst author’s master
thesis, supported by Adnan Menderes University Scientifc
Research Projects Unit (Project Number: VTF 13044) and
the authors would like to thank Prof. Dr. Bulent Bozdogan
(Adnan Menderes University, Medical Faculty, Department
of Medical Microbiology, Aydin, Turkey) for his help and
support.
REFERENCES
1. Jett, B.D., Huycke, M.M. and Gilmore, M.S.: Virulence of ente-
rococci. Clin. Microbiol. Rev. 7: 462-478, 1994.
2. Devriese, L.A., Laurier, L., De Herdt, P. and Haesebrouck, F.: En-
terococcal and streptococcal species isolated from faeces of calves,
young cattle and dairy cows. J. Appl. Bacteriol. 72: 29-31, 1992.
3. Pangallo, D., Harichová, J., Karelová, E., Drahovská, H., Cho-
vanová, K., Ferianc, P., Turňa, J. and Timko, J.: Molecular investiga-
tion of enterococci isolated from diferent environmental sources.
Biologia. 59: 829-837, 2004.
4. An, F.Y., Sulavik, M.C. and Clewell, D.B.: Identifcation and
characterization of a determinant (eep) on the Enterococcus faecalis
chromosome that is involved in production of the peptide sex
pheromone cAD1. J. Bacteriol. 181: 5915-5921, 1999.
5. Eaton, T.J. and Gasson, M.J.: Molecular screening of Enterococcus
virulence determinants and potential for genetic exchange between
food and medical isolates. Appl. Environ. Microbiol. 67: 1628-
1635, 2001.
6. Singh, K.V., Coque, T.M., Weinstock, G.M. and Murray, B.E.:
In vivo testing of an Enterococcus faecalis efa A mutant and use of
efaA homologs for species identifcation. FEMS Immunol. Med.
Microbiol. 21: 323-331, 1998.
7. Shankar, V., Baghdayan, A.S., Huycke, M.M., Lindahl, G. and
Gilmore, M.S.: Infection-derived Enterococcus faecalis strains are
enriched in esp, a gene encoding a novel surface protein. Infect.
Immun. 67: 193-200, 1999.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 21 Virulence Genes of Enterococcus faecalis
8. Clewell, D.B., An, F.Y., Flannagan, S.E., Antiporta, M. and
Dunny, G.M.: Enterococcal sex pheromone precursors are part
of signal sequences for surface lipoproteins. Mol. Microbiol. 35:
246-247, 2000.
9. Galli, D., Lottspeich, F. and Wirth, R.: Sequence analysis of
Enterococcus faecalis aggregation substance encoded by the sex
pheromone plasmid pAD1. Mol. Microbiol. 4: 895-904, 1990.
10. Chow, J.W., Tal, L.A., Perri, M.B.,Vazquez, J.A., Donabedian,
S.M., Clewell, D.B. and Zervos, M. J.: Plasmid-associated hemo-
lysin and aggregation substance production contribute to virulence
in experimental enterococcal endocarditis. Antimicrob. Agents
Chemother. 37: 2474-2477, 1993.
11. Bradley, A.J., Leach, K.A., Breen, J.E., Green, L.E. and Green,
M.J.: Survey of the incidence and aetiology of mastitis on dairy
farms in England and Wales. Vet. Rec. 160: 253-257, 2007.
12. Nam, H.M., Lim, S.K., Moon, J.S., Kang, H.M., Kim, J.M., Jang,
K.C., Kim, J.M., Kang, M.I., Joo, Y.S. and Jung, S.C.: Antimicro-
bial resistance of enterococci isolated from mastitic bovine milk
samples in Korea. Zoonoses Public Health. 57: e59-64, 2010.
13. Østeras, O., Sølverød, L., and Reksen, O.: Milk culture results in
a large Norwegian survey – efects of season, parity, days in milk,
resistance, and clustering. J. Dairy Sci. 89: 1010-1023, 2006.
14. Kuyucuoglu, Y.: Antibiotic resistances of enterococci isolated from
bovine subclinical mastitis. Eurasian J. Vet. Sci. 27: 231-234, 2011.
15. Türkyılmaz, S., Yildiz, O., Oryasin, E., Kaynarca, S. and Boz-
doga, B.: Molecular identifcation of bacteria isolated from dairy
herds with mastitis. Kafkas Univ. Vet. Fak. Derg. 16: 1025-103,
2010.
16. Ozmen Togay, S., Celebi Keskin, A., Acik, L. and Temiz, A.:
Virulence genes, antibiotic resistance and plasmid profles of En-
terococcus faecalis and Enterococcus faecium from naturally fermented
Turkish foods. J. Appl. Microbiol. 109: 1084-1092, 2010.
17. Quinn, P.J., Carter, M.E., Markey, B.K. and Carter, G.R.: Clini-
cal Veterinary Microbiology. Mosby-Year Book Europe Limited,
Lynton House, London, England pp: 40-190, 1994.
18. Ke, D., Picard, F.J., Martineau, F., Menard, C., Roy, P.H., Ouel-
lette, M. and Bergeron, M.G.: Development of a PCR assay for
rapid detection of enterococci. J. Clin. Microbiol. 37: 3497-3503,
1999.
19. Vilela, M.A., Souz, S.L., Palazzo, I.C.V., Ferreira, J.C., Morais,
Jr M.A., Darini, A.L.C. and Morais, M.M.C.: Identifcation and
molecular characterization of Van A-type vancomycin-resistant
Enterococcus faecalis in Northeast of Brazil. Mem. Inst. Oswaldo
Cruz. 101: 716-719, 2006.
20. Bittencourt de Marques, E.B. and Suzart, S.: Occurrence of
virulence-associated genes in clinical Enterococcus faecalis strains
isolated in Londrina, Brazil. J. Med. Microbiol. 53: 1069-1073,
2004.
21. Lanthier, M., Scott, A., Zhang, Y., Cloutier, M., Durie, D., Hen-
derson, V.C., Wilkes, G., Lapen, D.R. and Topp, E.: Distribution
of selected virulence genes and antibiotic resistance in Enterococ-
cus species isolated from the South Nation River drainage basin,
Ontario, Canada. J. Appl. Microbiol. 110: 407-421, 2010.
22. Abriouel, H., Omar, N.B., Molinos, A.C., Lopez, R.L., Grande,
M.A., Martinez-Viedma, P., Ortega, E., Canamero, M.M. and
Galvez, A.: Comparative analysis of genetic diversity and incidence
of virulence factors and antibiotic resistance among enterococcal
populations from raw fruit and vegetable foods, water and soil, and
clinical samples. Int. J. Food Microbiol. 123: 38-49, 2008.
23. Valenzuela, A.S., Omar, N.B., Abriouel, H., Lopez, R.L., Ortega,
E., Canamero, M.M. and Galvez, A.: Risk factors in enterococci
isolated from foods in Morocco: determination of antimicrobial
resistance and incidence of virulence traits. Food Chem. Toxicol.
46: 2648-2652, 2008.
24. Denham, E.L., Ward, P.N. and Leigh, J.A. Lipoprotein signal
peptides are processed by Lsp and Eep of Streptococcus uberis. J.
Bacteriol. 190: 4641-4647, 2008.
25. Smedo, T., Almeida Santos, M., Martins, P., Silva Lopes, M.F.,
Figueiredo Marques, J.J., Tenreiro, R. and Barreto Crespo, M.T.:
Comparative study using type strains and clinical food isolates to
examine hemolytic activity and occurrence of the cyl operon in
enterococci. J. Clin. Microbiol. 41: 2569-2576, 2003.
Research Articles