Embedded Scribd iPaper - Requires Javascript and Flash Player

Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 Yadav, R. 36
Typing of Staphylococcus aureus Obtained from Mastitic Milk of Cattle
and Bufalo on the Basis of Coagulase (coa) Gene RFLP Patterns
Yadav, R.,
1
* Sharma, S.K.,
2
Yadav, J.,
3
Nathawat, P.
1
and Kataria, A.K.
1
1
Department of Veterinary Microbiology and Biotechnology. College of Veterinary and Animal Sciences, Bikaner. Rajasthan
University of Veterinary and Animal science, Bikaner-334001 (Rajasthan), India.
2
Department of Veterinary Microbiology and Biotechnology. Post Graduate Institute of Veterinary Education and Research
(PGIVER), Jaipur. Rajasthan University of Veterinary and Animal science, Bikaner-334001 (Rajasthan), India.
3
College of Veterinary and Animal Sciences, Hisar. Lala Lajpat Rai University of Veterinary & Animal Sciences,
Hisar-125001 (Haryana), India.
*
Corresponding Author: Dr. Yadav, R., Department of Veterinary Microbiology and Biotechnology, Rajasthan University of Veterinary and Animal science,
Bikaner-334001 (Rajasthan), India. Phone: 09466930987, 09694065689. E-mail: drrahul16889@gmail.com
ABSTRACT
A typing procedure based on polymorphism of the coagulase gene (coa) was used to discriminate 32
Staphylococcus aureus isolates obtained from cattle (n=16) and bufalos’ (n=16) mastitic milk. All the isolates
showed coagulase production on plasma obtained from various species of animals and human. Amplifcation
of coa PCR products (400bp, 510bp, 600bp and 650bp) were produced from cattle isolates and fve diferent
products (400bp, 510bp, 600bp, 650bp and 680bp) from bufalo isolates. From four coagulase types in cattle
isolates fve restriction fragment length polymorphism (RFLP) patterns were obtained and from fve coagulase
types in bufalo isolates six RFLP patterns were obtained. Te coa gene amplicon of 600 bp was produced
by the maximum number of isolates.
Keywords: Staphylococcus aureus; Cattle, Bufalo; Mastitis; coa gene; RFLP
INTRODUCTION
Mastitis causes considerable economic loss to the dairy
industry. Although several bacterial pathogens can cause
mastitis, Staphylococcus aureus is probably the most peril-
ous agent as it causes chronic and deep infection in the
mammary glands that are extremely difcult to cure (1,
2). Considerable genetic heterogeneity has been shown in
natural populations of S. aureus isolates therefore, an exact
identifcation of bacterial pathogens is necessarily for moni-
toring the spread of infection in animal populations (3, 4).
Among numerous molecular techniques, coagulase (coa)
gene typing is considered a simple and efective method for
categorizing S. aureus isolates for epidemiological studies
(5). Coagulase is an extracellular protein encoded by coa
gene that possesses a conserved and a repeated polymorphic
region that can be used to measure relatedness among S.
aureus isolates (6, 7, 8).
Te present study was designed to type S. aureus on the
basis of polymerase chain reaction (PCR) and PCR-based
restriction fragment length polymorphism (RFLP) analysis
of the 3’ end of the gene encoding staphylococcal coagulase.
MATERIAL METHODS
Samples were collected from cattle and bufalo without
discriminating age, breed, calving and lactation yield from
District Bikaner (28.0167°N, 73.3119°E), Rajasthan, India
during December 2012 (Winter) to May 2013 (Summer).
Te only criteria were for sampled cattle and bufalo to be
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 37 S. aureus Mastitis coa Gene RFLP
sufering by clinical mastitis. All animal (cattle and bufalo)
were Indian origin and reared at dairies and local farmers.
Sample collection, isolation and identifcation
In the present investigation a total of 89 mastitic milk
samples (41 from cattle and 48 from bufalo) were pro-
cessed for isolation and phenotypic identifcation (9). All
the phenotypically identifed S. aureus samples were further
confrmed based on 23S rRNA gene ribotyping (10). Te
following sequences for the two primers were used: Primer
1 – 5’ ACGGAGTTACAAAGGACGAC 3’ Primer 2 – 5’
AGCTCAGCCTTAACGAGTAC 3’.Te reaction mixture
of 30 µl was prepared by mixing 20 µl deionised water, 3.0 µl
10x DreamTaq Green bufer, 1.8 µl MgCl
2
,
0.5 µl Primer-1
(10 pM/µl), 0.5 µl Primer-2 (10 pM/µl), 0.6 µl dNTP-mix
(10mM), 0.1 µl DreamTaq DNA polymerase (5U/µl) and
2.5 µl template DNA (25ng/ µl). Primers and the PCR assay
kit were obtained from Termo Fisher Scientifc, Waltham,
MA, USA. Amplifcation was carried out in a Veriti thermal
cycler (Applied Biosystem, Lincoln Centre Drive, Foster
City, CA 94404, USA) as follows: initial cycle of amplifca-
tion (denaturation at 94°C for 5 min, primer annealing at
55°C for 30 sec and primer extension at 70°C for 75 sec),
36 cycles of amplifcation (denaturation at 94°C for 40 sec,
primer annealing at 57°C for 60 sec and primer extension at
70°C for 75 sec) and fnal cycle of amplifcation (denaturation
at 94°C for 60 sec, primer annealing at 57°C for 60 sec and
primer extension at 70°C for 3 min). Te PCR products were
resolved in 1.2% agarose gels.
Phenotypic characterization of coagulase production
Te genotypically confrmed 32 (16 from cattle and 16 from
bufalo) S. aureus isolates were tested for coagulase production
(9) using plasma from diferent animal species viz. bufalo,
sheep, goat, dog, chicken, camel and pig, and humans. Te
varying degrees of plasma clotting reactions were observed at
the interval of 1, 3, 5 and 24 hours after incubation in water
bath at 37°C.
Amplifcation and RFLP of coa gene
Amplifcation of the coa gene was carried out as described
by Hookey et al. (11) with some modifcation using forward
primer 5’ ATAGAGATGCTGGTACAGG 3’ and reverse
primer 5’ GCTTCCGATTGTTCGATGC 3’. Te reaction
mixture of 30 µl was prepared by mixing 20 µl deionised
water, 2.5 µl 10x DreamTaq Green bufer, 2.5 µl MgCl
2
, 0.5
µl Primer-1 (10 pM/µl), 0.5 µl Primer-2 (10 pM/µl), 1.0 µl
dNTP-mix (10mM), 0.5 µl DreamTaq DNA polymerase
(5U/µl) and 2.5 µl template DNA (25ng/ µl). Primers and the
PCR assay kit were obtained from Termo Fisher Scientifc,
Waltham, MA, USA. Amplifcation was carried out in a
Veriti thermal cycler (Applied Biosystem, Lincoln Centre
Drive, Foster City, CA 94404, USA) as follows: initial cycle
of amplifcation (denaturation at 94°C for 45 sec, primer
annealing at 57°C for 15 sec and primer extension at 70°C
for 15 sec), 28 cycles of amplifcation (denaturation at 94°C
for 20 sec, primer annealing at 57°C for 15 sec and primer
extension at 70°C for 15 sec) and fnal cycle of amplifcation
(denaturation at 94°C for 45 sec, primer annealing at 57°C
for 15 sec and primer extension at 70°C for 2 min). Te PCR
products were resolved in 1.2% agarose gels.
For restriction fragment length polymorphism of PCR
coa gene products digestion by Alu I (restriction enzyme
from Termo Fisher Scientifc, Waltham, MA, USA) was
carried out (11). Te PCR product (10 µl) was added with 5
µl nuclease free water, 2 µl 10x Bufer Tango and 2U AluI (5
U/µl), mixed gently and incubated at 37°C for 3 h and the
digests were resolved in 2% agarose gels.
RESULTS AND DISCUSSION
Te phenotypically identifed isolates were further confrmed
by ribotyping (10) where an amplicon of 1250 bp was ob-
tained in the 32 isolates. On phenotypic characterization of
the 32 isolates for production of coagulase revealed that all
the isolates produced coagulase. Our results are in agree-
ment to those of Arshad et al. (12) who investigated 23 S.
aureus isolates obtained from cattle and bufalo. Some of the
isolates showed weak coagulation reaction even after 5 h of
incubation however they all showed a strong reaction at the
24 h reading. Rayman et al. (13) and Turkyilmaz and Kaya
(14) also reported the coagulation of plasma after 24 h. In the
present study human plasma showed the best coagulation re-
action followed by plasma from pig, dog, poultry, sheep, goat,
camel and bufalo in decreasing order for isolates from both
species. Te results suggest that the use of human plasma for
the coagulase test for S. aureus was preferable.
Since the coagulation reactions were carried out under
similar atmospheric conditions the analysis suggested that
this reaction is more dependent on the source of the plasma
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 Yadav, R. 38
than the isolates. Our results are in complete agreement
to those of Kateete et al. (15), where human plasma was
recorded to give the best coagulation results. Tough most of
the workers have defned the coagulase reaction in terms of
frmness of the clot and superiority of plasma for a particular
species, Turner and Schwartz (16) suggested that any degree
of clotting in the coagulase plasma should be considered as
a positive reaction.
Amplifcation of coa gene
It has been described that varying numbers (3 to 9) of 81-
bp tandem repeats in the coa gene in S. aureus determine
the sequence analysis (3, 17). Te PCR amplifcation of this
particular region produces DNA fragments of diferent sizes
which can be further discriminated by restriction fragment
length polymorphism (RFLP) after digestion with AluI
restriction enzyme (18). In the present investigation, all the
S. aureus isolates from cattle origin were grouped into four
coagulase types based on the size of coa amplicons obtained
where 10 isolates produced amplicon of 600 bp, four pro-
duced amplicons of 650 bp and amplicons of 510 bp and 400
bp were produced by one isolate each (Figure 1).
Te bufalo isolates were divisible into fve groups, where
six produced amplicon of 600 bp, fve produced amplicons of
680 bp, two produced amplicons of 650 bp and two of 510bp
and one isolate produced 400bp amplicon. Te overall results
revealed that 16, 6, 5, 3 and 2 isolates produced amplicons of
600, 650, 680, 510 and 400 bp, respectively (Figure 2).
Te present study was in agreement with the fndings of
Sanjiv et al. (19) and Upadhyay et al. (23) for coa amplicons
(650 and 680 bp) of S. aureus in bovine and caprine mastitic
milk. In the present study 50% of the isolates produced
amplicons of similar size (600bp) which is in accordance
with the observation of da Silva and da Silva (20); Aslantas
et al. (4) and Saei et al. (8) demonstrating that there may be
variety of coagulase types but only few types predominate
in a particular area. Te recovery of 600 bp amplicons in the
highest number of isolates is in accordance to the observation
of Salasia et al. (1), Khichar et al. (21) and Marques et al.
(22). Te amplicons of 400, 510 and 600 bp obtained in the
present study were earlier reported by previous workers from
the same laboratory (19, 23, 21) and also from elsewhere (5, 7,
1). In the present investigation the range of molecular size of
coa amplicons obtained was narrower (400-680 bp). Similar
observations were made by Sanjiv et al. (19) and Upadhyay et
al. (23) who obtained three types of amplicons from the same
study area. Similarly, Stephan et al. (24) recorded only two
types of coa amplicons from 34 S. aureus isolates. However, a
wide range of coa gene amplicons have been reported by vari-
ous workers viz. 579 to 1442 bp (20); 730-1050 bp (4); 710
to 1456 bp (25); 610 to 960 bp (26) and 400 to 800 bp (27).
Analysis of RFLP of coa gene products
From four coagulase types in cattle isolates, fve RFLP pat-
terns were obtained (Figure 3) and from fve coagulase types
in bufalo isolates, six RFLP patterns were obtained (Figure
4). Te pattern of RFLP was similar for 400, 600, 650 bp
amplicons for isolates from both cattle and bufalo. However,
510 bp amplicon was digested into 300 and 210 bp fragments
in cattle isolates and into 400 and 110 bp fragments in bufalo
isolates. Te 400 bp coa gene amplicon remained undigested
whereas amplicon of 600 bp showed two patterns. Out of
the 16 isolates producing amplicons of 600 bp, 12 isolates
showed a pattern wherein 300 bp fragments were obtained
Figure 2: Agarose gel electrophoresis of amplicons of coa gene of
S. aureus isolates obtained from bufalo with clinical mastitis.
Figure 1: Agarose gel electrophoresis of amplicons of coa gene of
S. aureus isolates obtained from cattle with clinical mastitis.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 39 S. aureus Mastitis coa Gene RFLP
whereas four of the isolates with 600 bp coa gene amplicon
produced fragment of 200 bp. Te digestion of 650 bp coa
gene amplicon in the isolates from both species of animals
produced 300, 200 and 150 bp fragments. Te amplicon of
680 bp obtained in bufalo isolates produced three fragments
of 400, 200 and 80 bp. Out of the total isolates 12 isolates
were similar as identifed by RFLP patterns.
Our observations of seven RFLP patterns in the pres-
ent study are similar to those of Himabindu et al. (28) who
observed nine diferent fragment sizes which were similar to
the fragment sizes obtained in the present study. A few of
the RFLP fragments viz. 400, 300, 210 and 110 bp obtained
in the present study were also reported by Sanjiv et al. (19),
Upadhyay et al. (23) and Khichar et al. (21) from bovine
and goat mastitis isolates from the same area of this study.
Fragment of 300 bp was produced by the maximum of iso-
lates (18) and fragment of 210 bp was produced by only one
isolate in our study.
In the present investigation one coagulase amplicon
of 400bp was not digested by AluI. Tis observation is in
agreement to fndings of Lange et al. (3) who also did not
observe digestion of three PCR products from S. aureus of
bovine mastitis origin. Similarly, da Silva and da Silva (20)
also observed non-digestion of some of the amplicons. In the
present study similar coa amplicons produced diferent RFLP
patterns. Similar to our observation, da Silva and da Silva,
(20) and Moon et al. (5) also recorded that the isolates with
similar coa amplicon have generated diferent RFLP patterns.
CONCLUSION
In the present investigation 32 genetically confrmed coagu-
lase positive S. aureus isolates from cattle and bufalo mastitic
mik were subjected to coa gene RFLP typing. Of the 16 cattle
and 16 bufalo isolates fve and six, respectively RFLP types
were obtained. Te study recorded RFLP polymorphism
even in similar coa amplicons. Te RFLP tying was found
satisfactory to discriminate the S. aureus isolates.
REFERENCES
1. Salasia, S.I.O., Khusnan, Z., Lammler, C. and Zschock, M.:
Comparative studies on henotypic and genotypic properties of
Staphylococcus aureus isolated from bovine subclinical mastitis in
central Java in Indonesia and Hesse in Germany. J. Vet. Sci. 5,
103-109, 2004.
2. Katsuda, K., Hata, E., Kobayashi, H., Kohmoto, M., Kawashima,
K., Tsunemitsu, H. and Eguchi, M.: Molecular typing of Staphy-
lococcus aureus isolated from bovine mastitic milk on the basis of
toxin genes and coagulase polymorphisms. Vet. Microbiol. 105:
301-305, 2005.
3. Lange, C., Cardoso, M., Senczek, D. and Schwarz, S.: Molecular
subtyping of Staphylococcus aureus isolates from cases of bovine
mastitis in Brazil. Vet. Microbiol. 67: 127-141, 1999.
4. Aslantas, O., Demir, C., Turutoglu, H., Cantekin, Z., Ergun, Y.
and Dogruer, G.: Coagulase gene polymorphism of Staphylococcus
aureus isolated from subclinical bovine mastitis. Turk. J. Vet. Anim.
Sci. 31: 253-257, 2007.
5. Moon, J.S., Lee, A.R., Kang, H.M., Lee, E.S., Joo, Y.S., Park, Y.H.,
Kim, M.N. and Koo, H.C.: Antibiogram and coagulase diversity
in Staphylococcal enterotoxin producing Stapylococcus aureus from
bovine mastitis. J. Dairy. Sci. 90: 1716-1724, 2007.
6. Schlegelova, J., Dendis, M., Benedik, J., Babak, V. and Rysanek,
Figure 3: Agarose gel electrophoresis of amplicons of Alu I digests of
coa gene amplicons (RFLP) of S. aureus isolates obtained from cattle
with clinical mastitis.
Figure 4: Agarose gel electrophoresis of amplicons of Alu I digests of
coa gene amplicons (RFLP) of S. aureus isolates obtained from bufalo
with clinical mastitis.
Research Articles
Israel Journal of Veterinary Medicine  Vol. 70 (4)  December 2015 Yadav, R. 40
D.: Staphylococcus aureus isolates from dairy cows and humans on
a farm difer in coagulase genotype. Vet. Microbiol. 92: 327-34,
2003.
7. Coelho, S.M.O., Reinoso, E., Pereira, I.A., Soares, L.C., Demo,
M., Bogni, C. and Souza, M.M.S.: Virulence factors and anti-
microbial resistance of Staphylococcus aureus isolated from bovine
mastitis in Rio de Janeiro. Pesquisa. Vet. Brasil. 29: 369-374,
2009.
8. Saei, H.D., Ahmadi, M., Mardani, K. and Batavani, R.A.: Mo-
lecular typing of Staphylococcus aureus isolated from bovine mastitis
based on polymorphism of the coagulase gene in the north west
of Iran. Vet. Microbiol. 137: 202-206, 2009.
9. Quinn, P.J., Carter, M.E., Markey, B.K. and Carter, G.R.: Clinical
Veterinary Microbiology. Wolfe Publishing, Mosby-Year Book
Europe Ltd. Lynton House, pp. 7-12. Tavistock Square, London
WCH 9LB, England, 1999.
10. Straub, J.A., Hertel, C. and Hammes, W.P.: A 23S rRNA target
polymerase chain reaction based system for detection of Staphy-
lococcus aureus in meat starter cultures and dairy products. J. Food.
Protect. 62: 1150-1156, 1999.
11. Hookey, J.V., Richardson, J.F. and Cookson, B.D.: Molecular typ-
ing of Staphylococcus aureus based on PCR restriction fragment
length polymorphism and DNA sequence analysis of the coagulase
gene. J. Clin. Microbiol. 36: 1083-1089, 1998.
12. Arshad, M., Muhammad, G., Siddique, M., Ashraf, M. and Khan,
H.A.: Staphylococcal mastitis in bovines and some properties of
Staphylococcal isolates. Pak. Vet. J. 26: 20-22, 2006.
13. Rayman, M.K., Park, C.E., Philpott, J. and Todd, E.C.D.: Re-
assessment of the coagulase and thermostable nuclease tests as
means of identifying Staphylococcus aureus. J. Appl. Microbiol. 29:
451-454, 1975.
14. Turkyilmaz, S. and Kaya, O.: Determination of some Virulence
factors in Staphylococcus spp. isolated from various clinical sam-
ples. Turk. J. Vet. Anim. Sci. 30: 127-132, 2005.
15. Kateete, D.P., Kimani, C.N., Katabazi, F.A., Okeng, A., Okee,
M.S., Nanteza, A., Joloba, M.L. and Najjuka, F.C.: Identifcation
of Staphylococcus aureus: DNase and mannitol salt agar improve
the efciency of the tube coagulase test. Ann. Clin. Microbiol.
Antimicrob. 9: 23, 2010.
16. Turner, F.J. and Schwartz, B.S.: Te use of a lyophilized human
plasma standardized for blood coagulation factors in the coagulase
and fbrinolytic tests. J. Lab. Clin. Med. 52: 888-894, 1958.
17. Scherrer, D., Corti, S., Muehlherr, J.E., Zweifel, C. Stephan, R.:
Phenotypic and genotypic characteristics of Staphylococcus aureus
isolates from raw bulk-tank milk samples of goats and sheep. Vet.
Microbiol. 101: 101-107, 2004.
18. Goh, S.H., Byrne, S.K., Zhang, J.L. and Chow, A.W.: Molecular
typing of Staphylococcus aureus on the basis of coagulase gene poly-
morphisms. J. Clin. Microbio. 30: 1642-1645, 1992.
19. Sanjiv, K., Kataria, A.K., Sharma, R. and Singh, G.: Epidemiologi-
cal typing of Staphylococcus aureus by DNA restriction fragment
length polymorphism of coa gene. Vet. Arhiv. 78: 31-38, 2008.
20. da Silva, E.R. and da Silva, N.: Coagulase gene typing of Staphy-
lococcus aureus isolated from cows with mastitis in southeastern
Brazil. Can. J. Vet. Res. 69: 260-264, 2005.
21. Khichar, V., Kataria, A. K. and Sharma, R.: Characterization of
Staphylococcus aureus of cattle mastitis origin for two virulence-
associated genes (coa and spa). Comparative Clinical Pathology.
DOI: 10.1007/s00580-012-1657-5, 2012.
22. Marques, V.F., de Souza, M.M.S., de Mendonca, E.C.L., de
Alencar, T.A., Pribul, B.R., Coelho, S.M.O. and Reinoso, M.L.E.:
Phenotypic and genotypic analysis of virulence in Staphylococcus
spp. and its clonal dispersion as a contribution to the study of
bovine mastitis. Pesquisa. Vet. Brasil. 33: 161-170, 2013.
23. Upadhyay, A., Kataria, A.K. and Sharma, R.: Coagulase gene-
based typing of Staphylococcus aureus from mastitic cattle and
goats from arid region in India. Comp. Clin. Path. DOI 10.1007/
s00580-010-1141-z, 2010.
24. Stephan, R., Annemuller, C., Hassan, A. and Lammler, C.: Char-
acterization of enterotoxigenic Staphylococcus aureus strains isolated
from bovine mastitis in north-east Switzerland. Vet. Microbiol.
78: 373-382, 2001.
25. Tiwari, H.K., Sapkota, D. and Sen, M.R.: Evaluation of diferent
tests for detection of Staphylococcus aureus using coagulase (coa)
gene PCR as the gold standard. Nepal. Med. Coll. J. 10: 129-131,
2008.
26. Sindhu, N., Sharma, A., and Jain, V.K.: Coagulase gene based
molecular detection of Staphylococcus aureus directly from mastitic
milk samples of Murrah bufalo. Bufalo Bulletin. 29: 52-59, 2010.
27. Abeer, A.A.A.A., Bashandy, M.M., Yashin, M.H. and Ibrahim,
A.K.: Assessment of conventional and molecular features of
Staphylococcus aureus isolated from bovine milk samples and contact
dairy workers. Global Veterinaria. 4: 168-175, 2010.
28. Himabindu, M., Muthamilselvan, D.S., Bishi, D.K. and Verma,
R.S.: Molecular analysis of coagulase gene polymorphism in clini-
cal isolates of methicilin resistant Staphylococcus aureus by restric-
tion fragment length polymorphism based genotyping. Am. J.
Infect. Dis. 5: 163-169, 2009.
Research Articles